WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharyngeal-intestinal valve; Larval Expression: pharyngeal-intestinal valve; hypodermis; Primary Identifier  Expr6566
Remark  Also expressed in (comments from author) : No comments. Strain: BC15043 Reporter Gene  [ref-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCTAAAGATGCCGACGAGATTAC] 3' and primer B 5' [GTACTGATGAGGACGATTTCTGG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine. pharyngeal-intestinal valve cardia WBbt:0005767
Epidermal layer. hypodermis epidermis WBbt:0005733

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004334 ref-1 T01E8.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023