WormMine: Gene WBGene00004334

• WormBase Gene ID: WBGene00004334
• Gene Name: ref-1
• Sequence Name: T01E8.2
• Brief Description: ref-1 encodes a protein with two basic helix-loop-helix (bHLH) domains that is distantly related to the hairy/Enhancer of split subfamily of bHLH transcription factors; REF-1 is required in hermaphrodites during early larval development for regulating the pattern of posterior Pn.p hypodermal cell fusions, primarily through regulation of MAB-5 homeodomain protein activity; REF-1 is also required for head morphogenesis and specification of the V6 lateral seam cell fate; in males, ref-1 is a target of MAB-3 transcriptional repression which in turn, promotes expression of LIN-32, a proneural bHLH transcription factor.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in several processes, including epidermal cell fate specification; negative regulation of transcription by RNA polymerase II; and nematode male tail tip morphogenesis. Located in nucleus. Expressed in several structures, including E lineage cell; embryonic cell; intestine; mc3V; and pharyngeal cell. Is an ortholog of human HES5 (hes family bHLH transcription factor 5).
• Biotype: SO:0001217
• Genetic Position: II :2.25358 ±0.013928
• Length (nt): 1552

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004334

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T01E8.2.1	T01E8.2.1	1392	II: 10218471-10220022

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T01E8.2	T01E8.2	1104	II: 10218473-10218615

36 RNAi Result

• WBRNAi00052130
• WBRNAi00026149
• WBRNAi00027450
• WBRNAi00017974
• WBRNAi00084007
• WBRNAi00104486
• WBRNAi00104485
• WBRNAi00104488
• WBRNAi00104487
• WBRNAi00070920
• WBRNAi00104490
• WBRNAi00104489
• WBRNAi00104492
• WBRNAi00104491
• WBRNAi00104494
• WBRNAi00104493
• WBRNAi00104496
• WBRNAi00104495
• WBRNAi00104498
• WBRNAi00104497
• WBRNAi00104500
• WBRNAi00104499
• WBRNAi00104502
• WBRNAi00104501
• WBRNAi00104504
• WBRNAi00104503
• WBRNAi00104506
• WBRNAi00104505
• WBRNAi00104508
• WBRNAi00104507

36 Allele

• gk963801
• gk963053
• gk962682
• WBVar01439384
• WBVar01439383
• gk963755
• gk963756
• gk405038
• oy40
• gk425466
• gk444433
• gk932983
• gk901074
• gk446683
• gk612918
• gk505952
• ok288
• gk474107
• gk882464
• gk853479
• gk768999
• gk544342
• gk767977
• gk322215
• gk851026
• ez11
• ez6
• WBVar02033488
• mu220
• gk361441

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004334
• Start: 10218471
• End: 10220022
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_10220023..10222876
• Length (nt): 2854
• Chromosome Location: II: 10220023-10222876
• Organism: Caenorhabditis elegans

149 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in hda-1(RNAi) embryos comparing to control animals.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00067044:hda-1(RNAi)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in dauer arrested chd-7(gk290);daf-2(e1370) animals, comparing to dauer arrested daf-2(e1370) animals.	DESeq2 (v1.20.0) with a cutoff of 0.05 on false discoveryrate (FDR).	WBPaper00063926:chd-7(gk290)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L1-larva_expressed
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L1-larva_expressed
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA

16 Expression Patterns

• Primary Identifier: Expr10426
• Pattern: Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/

• Primary Identifier: Expr6566
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15043
• Reporter Gene: [ref-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCTAAAGATGCCGACGAGATTAC] 3' and primer B 5' [GTACTGATGAGGACGATTTCTGG] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; Larval Expression: pharyngeal-intestinal valve; hypodermis

• Primary Identifier: Expr7810
• Remark: Reporter gene fusion type not specified.
• Pattern: ref-1 was expressed in a few cells in the pharyngeal primordium of the embryo.

• Primary Identifier: Expr1032152
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr8128
• Remark: Picture: Figure 2I, 2J.
• Pattern: ref-1::GFP was expressed in pm8 and in the sister cells e2V and mc3V

• Primary Identifier: Expr8066
• Remark: Picture: Figure 4F.
• Pattern: ref-1 was expressed in all EMS granddaughters beginning at the 24-cell stage. Approximately 25 min after ABp first contacts a ligand-expressing cell at the four-cell stage, all ref-1 family members were expressed in the ABp granddaughters. No expression was detected in ABa descendants or descendants of other early blastomeres such as EMS or P3. The second Notch interaction begins at the 12-cell stage, when two of the four ABa descendants contact a ligand-expressing cell. The ref-1 family was expressed about 25 min later in the daughters of the two Notch-activated ABa descendants, but not in other ABa descendants; these same embryos continued to show expression in the ABp descendants activated by the first interaction.

• Primary Identifier: Expr3513
• Remark: A ref-1(2.0kb)::gfp transcriptional reporter showed the identical expression pattern as the ref-11.8kb::ref-1::gfp transgene Picture: Figure 2A, 2B, 2C.
• Pattern: ref-1(1.8kb)::ref-1::gfp expression first appeared in the left, Notch-activated E4 cells and persisted only in their daughters, the left E8 cells. Expression disappeared late in the E8 stage, but reappeared during the next cell cycle on the right side of the E16 primoridium.

• Primary Identifier: Expr3512
• Pattern: In wild-type males, REF-1::GFP can be detected in V6- and T-derived seam cells during the L1 and L2 larval stages. After L2, however, REF-1::GFP is undetectable in the V ray lineage.

• Primary Identifier: Expr10425
• Pattern: Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/

• Primary Identifier: Expr3979
• Pattern: Broad and dynamic GFP expression was observed in the embryo. GFP expression was seen in the nuclei of the ABplp(a/p), ABalp(a/p), ABprp(a/p), ABara(a/p), and weakly in the ABarp(a/p) blastomeres at approximately 100 min after fertilization. Expression was not seen in the ABpraa. GFP expression was maintained in the progeny of the ABara(a/p) blastomere through the next three cell divisions but was lost in additional blastomeres. In the subsequent cell divisions, GFP expression was maintained in the daughters of the ABaraap precursors which give rise to the NSM(L/R) neurons, but was downregulated in additional ABara(a/p) daughter and grand-daughter cells. GFP expression was weaker in subsequent cell divisions and was not followed further.
• Subcellular Localization: GFP was localized to the nuclei of all expressing cells as expected for a predicted transcription factor.

• Primary Identifier: Expr9691
• Pattern: ref-1 is expressed in specific subsets of E lineage cells and in other cells in the embryo. We found strong reporter expression in Eal and Epl cells but also weak reporter expression in both right daughters of Ex cells, with the level of expression correlated with the proximity of the cells to the MSapp cells. In wild type embryos Epl is further from the MSapp cell than Eal, and has a significantly lower level of ref-1 reporter expression (p-value = 6.2e-5). In addition Ear and Epr are yet more distant from MSapp and have still lower expression. Plotting ref-1 reporter expression versus distance from MSapp produces a high negative correlation.

• Primary Identifier: Expr1155762
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1023036
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2015292
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2033526
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1013
• Remark: Original chronogram file: chronogram.2070.xml
• Reporter Gene: [T01E8.2:gfp] transcriptional fusion.

16 GO Annotation

51 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004334
• Start: 10218471
• End: 10220022
• Strand: 1

16 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1552

1 Sequence Ontology Term

• Name: gene

6 Strains

• WBStrain00030923
• WBStrain00031131
• WBStrain00047502
• WBStrain00051984
• WBStrain00006448
• WBStrain00004843

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_10218431..10218470
• Length (nt): 40
• Chromosome Location: II: 10218431-10218470
• Organism: Caenorhabditis elegans