WormMine: ExpressionPattern Expr6512

• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; uterus; spermatheca uterine valve; gonad sheath cells; excretory gland cells; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in head; unidentified cells in body ; Larval Expression: intestine; rectal gland cells; Reproductive System; developing uterus; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in head; unidentified cells in body
• Primary Identifier: Expr6512
• Remark: Strain: DM11928
• Reporter Gene: [mdt-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTTCATTGAGTTTTCCCATAA] 3' and primer B 5' [TTCGCTGATCTTTCTACTCTGCT] 3'.

14 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
A valve tissue that connects the spermatheca and the uterus of a hermaphrodite gonad.	spermathecal-uterine junction	sp-ut valve	WBbt:0006756
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
gland cell of the secretory-excretory system, sends processes to ring, opens into excretory duct.	excretory gland cell	exc gl	WBbt:0005776
	rectal gland cell		WBbt:0005799
neuron of phasmid sensillum	phasmid neuron		WBbt:0006753
neuron of the amphid sensillum	amphid neuron	amphid sensory neuron	WBbt:0005394
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis.	gonadal sheath cell		WBbt:0005828
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00007016	mdt-15	R12B2.5	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023