WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Anatomy Term :

Definition  five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis. Name  gonadal sheath cell
Primary Identifier  WBbt:0005828

2 Children

Definition Name Synonym Primary Identifier
sheath cell of the posterior gonad arm. posterior gonadal sheath cell   WBbt:0006872
any of sheath cells of the anterior gonad arm. anterior gonadal sheath cell   WBbt:0006871

7 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Single-cell RNA-Seq cell group 18_0 expressed in gonad. scVI 0.6.0 WBPaper00065841:18_0
  Single-cell RNA-Seq cell group 79 expressed in: sh5 (gonadal sheath proximal). CellRanger, DecontX, Monocle3, Louvain algorithm. WBPaper00065623:79
  Single-cell RNA-Seq cell group 17 expressed in: sh2 (gonadal sheath distal). CellRanger, DecontX, Monocle3, Louvain algorithm. WBPaper00065623:17
  Single-cell RNA-Seq cell group 19 expressed in: sh3_sh4 (gonadal sheath proximal). CellRanger, DecontX, Monocle3, Louvain algorithm. WBPaper00065623:19
  Single-cell RNA-Seq cell group 4 expressed in: sh1 (gonadal sheath distal). CellRanger, DecontX, Monocle3, Louvain algorithm. WBPaper00065623:4
  Single-cell RNA-Seq cell group 7 expressed in: sh2 (gonadal sheath distal). CellRanger, DecontX, Monocle3, Louvain algorithm. WBPaper00065623:7
  Single-cell RNA-Seq cell group 42 expressed in: Unassigned hypodermis/gonadal sheath cells. CellRanger, DecontX, Monocle3, Louvain algorithm. WBPaper00065623:42

289 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4783 Prominent expression of ORAI-1::GFP was detected in the spermatheca, intestine and hypodermis. In the intact animal, it was unclear whether gonadal sheath cells expressed ORAI-1::GFP, due to the intense fluorescence from the intestine and spermatheca. To examine sheath cell expression further, authors imaged gonads dissected free from a worm strain expressing an orai-1 transcriptional GFP reporter. orai-1 is also expressed in both proximal and distal gonadal sheath cells. Intestinal expression appeared to be localized to both apical and basolateral membrane regions. The circumferential ORAI-1::GFP localization pattern is consistent with expression in the basal plasma membrane. Non-circumferential localization is probably due to membrane folding and/or expression at lateral cell borders. The complicated morphology of the spermatheca precluded definitive localization of ORAI-1::GFP to the apical cell membrane.
More detailed studies are required to identify the cellular domains in which STIM-1::GFP is expressed. It should be noted here that the absence of detectable STIM-1::GFP expression in tissues other than those shown does not rule out a functional role for STIM-1 in other cell types. The 1.9-kb stim-1 promoter used in these studies may lack regulatory information required for cell-specific expression. In addition, STIM-1::GFP expression levels may be below detection levels in other tissues. More definitive identification of STIM-1 expression sites awaits the development of suitable antibodies for immunolocalization.   Expr4260 Prominent expression of STIM-1::GFP was detected in the spermatheca, gonad sheath cells, the intestine, and neurons in the head. Expression was also detected in uterine epithelial cells. STIM-1::GFP-expressing head neurons are likely amphid and/or inner labial (IL) neurons. Expression of STIM-1::GFP in the intestine was heterogeneous. The anterior and posterior intestine expressed the reporter very strongly while expression was weaker in the midsection. Intestinal STIM-1::GFP appeared to be localized to membrane and submembrane regions. Confocal Z-sections also revealed a prominent punctate localization in the anterior intestine and sheath cells. STIM-1::GFP expression showed a striking localization to a reticular structure in the posterior intestine. This reticular structure resembles the ER of C. elegans intestinal cells.
Moreover, neither the dgn-1::GFP promoter reporter nor the rescuing DGN-1::GFP fusion show expression in muscle. Plasmid pJJ516 was made by inserting GFP from pPD114.38 into the HindIII site near the end of the dgn-1 coding sequence. The product contains GFP inserted after residue 575 of DGN-1, with the final seven DGN-1 residues at the C terminus. Expression of DGN-1::GFP is identical to that of the dgn-1::GFP promoter reporter, and DGN-1::GFP rescues the sterility of dgn-1(cg121).   Expr4218 In early (pre-morphological) embryos, dgn-1::GFP expression is evident in many epithelial and neural precursors comprising the outer layer of cells. As elongation begins at comma stage, expression becomes most prominent in several specialized epithelial cells, including pharyngeal e2 and marginal cells, excretory cells, the somatic gonad precursors (SGPs) Z1 and Z4, and rectal epithelial cells. Weaker expression is apparent in hypodermal precursors and neuroblasts along the ventral midline. Pharyngeal expression persists through the L3 larval stage, whereas excretory and rectal cell expression persists throughout development. SGP expression persists in SGP descendants, such as the distal tip cells (DTCs), and increases throughout the gonad during the L4 stage. Variable, generally weak expression is seen throughout larval development in several neurons, although PVP neurons show strong expression throughout development. Transient increased expression occurs in new P cell-derived neurons in the ventral nerve cord in late L1/early L2 stage animals. Variable weak expression is seen in hypodermal cells, principally hyp5 in the head. Preceding the L4/adult molt, expression increases in the vulval epithelium.  
    Expr4593 Transgenic animals expressing GFP under the control of the zfp-2 promoter showed fluorescence in vulval cells and all somatic gonad structures such as spermatheca, sheath cells, uterine cells and distal tip cells (DTCs).  
    Expr4566   Expressed consistently in the cytoplasm, and more variably in the nuclei, of 8 of the 10 sheath cells surrounding each gonad arm,
    Expr4565 Five independent transgenic lines revealed similar patterns of expression in gonadal sheath cells 1 to 4 and in a few head neurons.  
    Expr4663 ppk-1::GFP expression was observed in such somatic tissues as gonad sheath and spermatheca, distal tip cells, and uterine and vulva muscles. ppk-1::GFP also showed extensive expression in such neuronal cells as ventral nerve cord, neuronal cell bodies near the nerve ring, and tail neurons.  
Strain: BC13896 [C13C4.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCACTTCTCCTCTTATCGC] 3' and primer B 5' [GATTCTTCGACCCTAAAGTTTCAA] 3'. Expr5252 Adult Expression: Reproductive System; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  
Also expressed in (comments from author) : High intensity GFP may mask tissues. Strain: BC10894 [C13B9.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTATGACAAAATTTCTACGCGA] 3' and primer B 5' [CGGCGATCAACACGATTG] 3'. Expr5248 Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; Nervous System; ventral nerve cord; unidentified cells in body ; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in body ;  
Strain: BC10781 [let-502::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACCAGATGAGCAATTTTGT] 3' and primer B 5' [CTGCAGCTCGATTTTCGTC] 3'. Expr5238 Adult Expression: pharynx; Reproductive System; vulval muscle; gonad sheath cells; Nervous System; tail neurons; Larval Expression: pharynx; seam cells; unidentified cells in head;  
Strain: BC14110 [C10E2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAACACATTTTTCTCACATTG] 3' and primer B 5' [CTGGTGCACCTGTGATTTTCT] 3'. Expr5232 Adult Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; developing gonad; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in tail ;  
Strain: BC14332 [C06G1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATAAAATCTGCGCTGTGC] 3' and primer B 5' [ACCCTTTGCTCTCGCAAGT] 3'. Expr5191 Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; vulval muscle; gonad sheath cells; body wall muscle; seam cells; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; seam cells;  
Also expressed in (comments from author) : No comments. Strain: BC15491 [C06G3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAATTTTTGTAGAAAGTGTGGG] 3' and primer B 5' [TTTGTCGATTTTGAACTTGGG] 3'. Expr5192 Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons;  
Strain: BC14465 [C06H2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGCAAAGAAAAGGATAGTTCCA] 3' and primer B 5' [CGCCAGCTGATCTGGATT] 3'. Expr5195 Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in head; unidentified cells in tail ;  
Strain: BC14639 [C05D11.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGTCTTCGCACTCGCAC] 3' and primer B 5' [ATTCGTCCCACTGATGTCTTTT] 3'. Expr5174 Adult Expression: intestine; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; Larval Expression: intestine; body wall muscle; hypodermis;  
Also expressed in (comments from author) : unidentified cells in head, possibly neural Strain: BC13981 [C04C3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGTTTAGATTACGACCAGGC] 3' and primer B 5' [ACTTTCTCAGAGCGATTTCGAC] 3'. Expr5140 Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; unidentified cells in head; Larval Expression: pharynx; anal depressor muscle; body wall muscle; hypodermis; unidentified cells in head;  
Strain: BC14237 [C03H5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCATTTTCCATTTTCGTC] 3' and primer B 5' [TCGTTAGCTCGATTGATGG] 3'. Expr5136 Adult Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;  
Also expressed in (comments from author) : Some punctate pattern in head and tail that may be neural. Strain: BC12276 [C03C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAGTTTTCGTGAATCCTCCT] 3' and primer B 5' [ATTGTTTGCTCTGATCGTGCT] 3'. Expr5123 Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ;  
Also expressed in (comments from author) : Whole animal has high intensity GFP. Strain: BC12279 [C02E11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGTTCCCGACAAAAATATGG] 3' and primer B 5' [TAAAGAACCGATGATCTGGAAAA] 3'. Expr5108 Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells;  
Also expressed in (comments from author) : Mosaic population. Strain: BC11019 [ost-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCAATAAACAAAACACATCTGG] 3' and primer B 5' [GACGGCGAATGAAGAGGA] 3'. Expr5494 Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head;  
Strain: BC15358 [rpl-34::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCGATGAGACATTTCCGA] 3' and primer B 5' [TAACGCGGAGGGAGATTTTT] 3'. Expr5485 Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons;  
Also expressed in (comments from author) : High intensity GFP.Mosaic population. Strain: BC14155 [rab-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTAAGCCAAAGCCAAAGCC] 3' and primer B 5' [TGCTGCCATCTCCTTTTTG] 3'. Expr5476 Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; Reproductive System; distal tip cell; developing gonad; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail ;  
Also expressed in (comments from author) : Unidentified cells in head and around vulva. Strain: BC11105 [C37E2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCACCGAGTAAAATACGCAA] 3' and primer B 5' [AGGATGCTGAAAACATTGGAGT] 3'. Expr5463 Adult Expression: pharynx; Reproductive System; vulva other; gonad sheath cells; body wall muscle; Nervous System; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: body wall muscle; Nervous System; tail neurons; unidentified cells in head; unidentified cells in body ;  
Strain: BC15422 [C37H5.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGTTATCCTATTTTCTCCCG] 3' and primer B 5' [TGTTGGAAGACGTGATCTGC] 3'. Expr5466 Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons;  
Also expressed in (comments from author) : very low intensity GFP. Strain: BC12898 [eif-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCAGTGCGAATCTCGTC] 3' and primer B 5' [TCAACCGGGAAACTGGAA] 3'. Expr5524 Adult Expression: pharynx; intestine; rectal epithelium; Reproductive System; vulva other; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells; Larval Expression: pharynx; intestine; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells;  
Also expressed in (comments from author) : unidentified GFP pattern in gonadal region in L4 animals Strain: BC12847 [C30H6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGAAAATTGTATGTTGGGGAAA] 3' and primer B 5' [ACCTTCGGACATGATTTTATGTAG] 3'. Expr5393 Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; vulva other; spermatheca; gonad sheath cells; hypodermis; Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing vulva; hypodermis; unidentified cells in body ;  
Strain: DM12665 [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'. Expr5383 Adult Expression: pharynx; intestine; Reproductive System; uterine-seam cell; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: pharynx; intestine; Reproductive System; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; phasmids;  
Also expressed in (comments from author) : Possibly seeing arcade cells. Strain: BC12665 [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'. Expr5385 Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; uterine-seam cell; vulva other; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing vulva; uterine-seam cell; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; unidentified cells in body ;unidentified cells in tail ;  
Also expressed in (comments from author) : No comments. Strain: BC15469 [spp-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCTTCTCACATCGTTCAATCGT] 3' and primer B 5' [GGATGAAATACTTGATTCTGAAAA] 3'. Expr5367 Adult Expression: intestine; anal depressor muscle; Reproductive System; gonad sheath cells; body wall muscle; Larval Expression: intestine; anal depressor muscle; Reproductive System; gonad sheath cells; body wall muscle; Nervous System; head neurons; tail neurons;  
Strain: BC14065 [C23H4.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTGCAAAAATAGACGTTGAACC] 3' and primer B 5' [GATCACGCCTAAAATTGATGGT] 3'. Expr5318 Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; neurons along body; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; neurons along body; unidentified cells in tail ;  

0 Life Stages

3 Parents

Definition Name Synonym Primary Identifier
  muscle of the reproductive system   WBbt:0005786
somatic (not germline) cell of the hermaphrodite gonad. hermaphrodite somatic gonadal cell   WBbt:0007815
  smooth muscle   WBbt:0005781