WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: rectal epithelium; hypodermis; Larval Expression: rectal epithelium; hypodermis; Primary Identifier  Expr6614
Remark  Strain: BC12841 Reporter Gene  [T05C12.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTTTGTATGCCCAATTTTTGT] 3' and primer B 5' [GCCGCCGGATCTTAAATATAG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004264 qua-1 T05C12.10 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023