WormMine: Gene WBGene00004264

• WormBase Gene ID: WBGene00004264
• Gene Name: qua-1
• Sequence Name: T05C12.10
• Brief Description: qua-1 encodes a hedgehog-like protein, with (from N- to C-terminus) asignal sequence, a Qua domain, a 5W repeat, an extended region oflow-complexity sequence, and a Hint/Hog domain; QUA-1 is conserved amongnematodes from Caenorhabditis to Brugia; QUA-1 is expressed prior tomolting in hyp1 to hyp11 hypodermal cells, but not in seam cells, andceases to be expressed after each molting cycle or in gravid adults nolonger molting; QUA-1 is strongly required for normal molting, withlethal molting defects in qua-1 mutants and severe defects inqua-1(RNAi) animals; similar molting defects in RNAi of ptr-4 and ptr-23(encoding Dispatched homologs) suggest that PTR-4 and PTR-23 may exportQUA-1 from hypodermal cells synthesizing it; other sites of QUA-1expression include intestinal and rectal cells, excretory duct and porecells, sensilla support cells, the P cell lineage in L1, body wallmuscle, and the adult reproductive system; QUA-1 is also required fornormal adult alae formation, growth to full size, cuticle adhesion,locomotion, and male tail development; the Hint/Hog domain is predictedto cut QUA-1 into two halves and then covalently link cholesterol to theC-terminus of the Qua domain; the Qua domain is predicted to form acysteine-crosslinked protein involved in intercellular signalling, andthe Qua domain has subtle similarity to the N-terminal Hedge domain ofHEDGEHOG proteins; both Qua and Hint/Hog domains are required fortransgenic rescue of a lethal qua-1 allele; defects in both qua-1mutants and qua-1(RNAi) animals; all of QUA-1's functions may reflectcommon defects in cholesterol-dependent hedgehog-like signalling.
• Organism: Caenorhabditis elegans
• Automated Description: Involved in molting cycle and nematode larval development. Acts upstream of or within nematode male tail mating organ morphogenesis. Located in collagen and cuticulin-based cuticle extracellular matrix. Expressed in several structures, including P1; P12; P2; excretory system; and hypodermal cell.
• Biotype: SO:0001217
• Genetic Position: II :0.749646 ±0.000106
• Length (nt): 5202

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004264

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T05C12.10.1	T05C12.10.1	3853	II: 8198803-8204004

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T05C12.10	T05C12.10	3510	II: 8198803-8198895

33 RNAi Result

• WBRNAi00096311
• WBRNAi00095709
• WBRNAi00096309
• WBRNAi00002148
• WBRNAi00052488
• WBRNAi00009113
• WBRNAi00026188
• WBRNAi00077027
• WBRNAi00078226
• WBRNAi00066810
• WBRNAi00077005
• WBRNAi00064560
• WBRNAi00064845
• WBRNAi00035190
• WBRNAi00068529
• WBRNAi00068530
• WBRNAi00068531
• WBRNAi00076978
• WBRNAi00068973
• WBRNAi00068975
• WBRNAi00068974
• WBRNAi00096847
• WBRNAi00095884
• WBRNAi00095961
• WBRNAi00096036
• WBRNAi00096113
• WBRNAi00096190
• WBRNAi00096267
• WBRNAi00096360
• WBRNAi00096443

70 Allele

• gk963801
• gk963053
• gk962682
• tm11435
• gk964408
• WBVar01695764
• WBVar01604266
• WBVar01604267
• h12890
• h17911
• gk714635
• gk874606
• gk400044
• gk779076
• gk441755
• gk711050
• gk507277
• gk590904
• gk615402
• gk467045
• gk626991
• gk916284
• gk756608
• gk312347
• gk564535
• gk388399
• gk740021
• gk482397
• gk581157
• gk915603

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004264
• Start: 8198803
• End: 8204004
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_8204005..8204338
• Length (nt): 334
• Chromosome Location: II: 8204005-8204338
• Organism: Caenorhabditis elegans

336 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts enriched in AMso according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:AMso_enriched
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Genes that showed increased expression after nicotic acid (NA) treatment.	Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed.	WBPaper00044260:nicotinc-acid_upregulated
	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite npr-8(ok1439) animals grown at 20C, comparing to in N2 animals.	CuffDiff, fold change > 2.	WBPaper00065096:npr-8(ok1439)_upregulated_Day1_20C
	Transcripts that showed significantly decreased expression in npr-8(ok1439) animals with 24 hour exposure to P. aeruginosa PA14, comparing to N2 animals with 24 hour exposure to P. aeruginosa PA14.	DESeq2, fold change > 1.5, FDR < 0.05.	WBPaper00058948:npr-8(ok1439)_downregulated_PA14

11 Expression Patterns

• Primary Identifier: Expr4344
• Pattern: qua-1pro::GFP was found to be expressed in the hypodermal cells covering the whole body from the tip of the nose to the tip of the tail spike, but not in the lateral hypodermal cells, i.e., the seam cells. Furthermore, expression was seen in the excretory duct and pore cells from threefold stage embryos to adults. However, in adults the GFP intensity appears weaker than in larvae. In L1 larvae, qua-1 is expressed in two, sometimes four, cells of the anterior as well as the posterior of the intestine and a rectal epithelial cell. In addition, transient expression was observed in the P cells in L1 in the ventral side of the animal and in a few sensilla support cells in the head. In adults, qua-1pro::GFP is transiently expressed in a few cells in the head that remain to be identified.

• Primary Identifier: Expr6613
• Remark: Strain: BC12591
• Reporter Gene: [T05C12.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTTTGTATGCCCAATTTTTGT] 3' and primer B 5' [GCCGCCGGATCTTAAATATAG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; body wall muscle; hypodermis; unidentified cells in tail ; Larval Expression: body wall muscle; hypodermis

• Primary Identifier: Expr6614
• Remark: Strain: BC12841
• Reporter Gene: [T05C12.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTTTGTATGCCCAATTTTTGT] 3' and primer B 5' [GCCGCCGGATCTTAAATATAG] 3'.
• Pattern: Adult Expression: rectal epithelium; hypodermis; Larval Expression: rectal epithelium; hypodermis

• Primary Identifier: Expr1032103
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr3690
• Pattern: Fluorescence was observed in epithelial cells that synthesize cuticle. Expressed in the hypodermis, including the major body syncytium, hyp7, and hypodermal cells in the head and tail. Expression of qua-1p::gfp in the hypodermis intensified prior to molting. Expression of the gfp fusion genes was never detected in the hypodermis of gravid adults that no longer molt.

• Primary Identifier: Expr1156112
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2015211
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2033445
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1861
• Remark: Original chronogram file: chronogram.78.xml
• Reporter Gene: [T05C12.10:gfp] transcriptional fusion.

• Primary Identifier: Expr1016217
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1911
• Remark: Original chronogram file: chronogram.831.xml
• Reporter Gene: [T05C12.10:gfp] transcriptional fusion.

12 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004264
• Start: 8198803
• End: 8204004
• Strand: 1

12 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5202

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00035500
• WBStrain00002356

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_8195116..8198802
• Length (nt): 3687
• Chromosome Location: II: 8195116-8198802
• Organism: Caenorhabditis elegans