WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; unidentified cells in tail ; Embryo Expression: body wall muscle; Larval Expression: pharynx; unidentified cells in tail ; Primary Identifier  Expr6791
Remark  Strain: BC12703 Reporter Gene  [T27E9.4a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGATTGAACATTCGTTAGGA] 3' and primer B 5' [AGATGCGAAGATTCTGAAATTGA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
posterior region, from rectum to the end tail   WBbt:0005741

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00002185 kel-3 T27E9.4 Caenorhabditis elegans

3 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching. embryo Ce WBls:0000003
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023