WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: unidentified cells; Larval Expression: Reproductive System; developing vulva; body wall muscle; unidentified cells; Primary Identifier  Expr6779
Remark  Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12944 Reporter Gene  [T26E3.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATGCACCATGTTTGTTT] 3' and primer B 5' [GAGATTTCTCGGCTTTCACG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00012037 T26E3.4 T26E3.4 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023