WormMine: ExpressionPattern Expr6773

• Pattern: Adult Expression: Reproductive System; vulval muscle; seam cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: seam cells; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr6773
• Remark: Strain: BC10574
• Reporter Gene: [set-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTACGCTCATCAGGCAGTAGTTT] 3' and primer B 5' [CCTTCGAGTGACACCGCT] 3'.

5 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail	seam cell	lateral hypodermis	WBbt:0005753
posterior region, from rectum to the end	tail		WBbt:0005741
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00004781	set-1	T26A5.7	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023