WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulval muscle; hypodermis; Larval Expression: Reproductive System; developing vulva; hypodermis; Primary Identifier  Expr6749
Remark  Strain: BC13467 Reporter Gene  [nas-27::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTATCGGAAGCAGAAAATTGG] 3' and primer B 5' [TCGATAGGTGTTTGCGTACTTTT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
Epidermal layer. hypodermis epidermis WBbt:0005733
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003545 nas-27 T23F4.4 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023