WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: uterine muscle; vulval muscle; Larval Expression: developing uterus; Primary Identifier  Expr6675
Remark  Also expressed in (comments from author) : No comments. Strain: BC13423 Reporter Gene  [nas-22::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGAAGTCGATATTCGAGAGA] 3' and primer B 5' [ACTGTGCTTGCAATTGTGCTT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
muscle lining of the uterine wall. uterine muscle   WBbt:0005342

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003541 nas-22 T11F9.6 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023