WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Anatomy Term :

Definition  muscle lining of the uterine wall. Name  uterine muscle
Primary Identifier  WBbt:0005342

2 Children

Definition Name Synonym Primary Identifier
Set two type of uterine muscle. um2 uterine muscle, type 2 WBbt:0006916
Set one type of uterine muscle. um1 uterine muscle, type 1 WBbt:0006915

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Single-cell RNA-Seq cell group 7_2 expressed in muscle. scVI 0.6.0 WBPaper00065841:7_2
  Single-cell RNA-Seq cell group 7_4 expressed in muscle. scVI 0.6.0 WBPaper00065841:7_4
  Single-cell RNA-Seq cell group 59 expressed in: Uterine muscle . CellRanger, DecontX, Monocle3, Louvain algorithm. WBPaper00065623:59

153 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Picture: Figure 8. Staining was greatly reduced in unc-87(e843).   Expr4809 The antibody react with body wall muscle, pharyngeal muscle, anal depressor and sphincter muscle, intestinal muscles, vulval muscles and uterine muscles. In all cases, UNC-87 was contained withing the pattern observed with phalloidin or anti-actin antibodies, suggesting colocalization with thin filaments.. Immunohistochemical staining of wild type adult body wall muscle revealed a atriated pattern. The striations are interupted periodically along their length by unstained regions. Double labelling experiments showed that anti-UNC-87 staining pattern corresponded with that of the monoclonal antibody MH44. This pattern represent the I band. At the center of the I band are the dense bodies, these correspond to the unstained regions within the striations.
    Expr4264 Expressed in body wall muscle cells, pharyngeal muscles, rectal gland cells, vulval and uterine muscles, and a subset of neurons in the head and ventral nerve cord. The expression was first detected in the embryo at the 1.5-fold stage and continued to be expressed until adulthood. In this stage, cells with position corresponding to P cells showed also GFP expression. In order to determine if the expression of GFP was in epidermal lineages, including P cells and their descendants, authors prepared double transgenic lines expressing GFP from promoter 1 of nhr-40 on the background of SU93 line that expresses an AJM::GFP membrane marker. This confirmed the expression of nhr-40::gfp in epidermal precursors P cells and their neuronal progeny within the ventral neuronal cord. However, the GFP was not observed in ventral epidermal cells that originated from P cells. The nhr-40::gfp was not observed in seam cells that are also marked by an AJM::GFP. The muscle pattern of expression was partially lost with truncations of this promoter fragments (-1013 and -682 bp); however, other aspects of expression were retained.  
    Expr4663 ppk-1::GFP expression was observed in such somatic tissues as gonad sheath and spermatheca, distal tip cells, and uterine and vulva muscles. ppk-1::GFP also showed extensive expression in such neuronal cells as ventral nerve cord, neuronal cell bodies near the nerve ring, and tail neurons.  
  For dre-1::gfp, a 4 kb promoter was amplified with primers 5' -GGTACCCGAGGGGACATCGAGATAG-3' and 5' -GGTACCTTCCTGGCCAACCAGAGAC-3' and was cloned into Fire vector L3781 (BA 279). The dre-1 ORF and the dre-1 3' UTR region were amplified with primers 5' -GCTAGCATGTCGTCCTCTTCGTCAC-3' and 5' -ACTAGTTACTTACTCCACTCCACACAG-3' and were cloned into BA279 (BA280). Lines containing this construct included dhEx346 and dhIs442. To obtain the full-length promoter construct, authors substituted the promoter from BA279 with a 12.3 kb promoter by using primers 5' -GCGGCCGCGTTGCACACAAAACATTATTATTTTCTTTCTCTT-3' and 5' -TACGTATCTCGTCCCTGAGATCTCTCATTT-3' (BA508). Resulting lines containing this array included dhEx443 and dhEx452. --precise ends. Expr4547 First detected by midembryogenesis, expression was most prominent in epidermal and intestinal cells. By the 1.5-fold stage of embryogenesis, expression was additionally detected in neurons and other cells. During larval and adult stages, DRE-1::GFP was most visible in epidermal seam cells and hypodermis. Expression was high in larvae and low in adults. In addition, DRE-1 was strongly expressed in the P epidermal blast cells and descendents that give rise to the vulva. Weak expression was seen in the somatic gonad, including the gonadoblasts, the anchor cell, dtcs, and occasionally adult spermatheca and uterus. Notably, with another construct (dhEx346, 4 kb promoter, 4 kb coding region), dtc expression was stronger and commenced by mid-L3. In the musculature, DRE-1 was seen in the pharynx, anal depressor, sex muscles, and body wall muscles. Finally, DRE-1 was detected in neurons of the head, tail, ventral cord, and periphery. Generally, DRE-1::GFP was localized to both the nucleus and cytoplasm, and it was broadly expressed, including in phenotypically affected tissues.
Strain: BC14107 [C10G8.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTAATTCTCCAGAATCGCAACT] 3' and primer B 5' [TATCGAGCCCTACGGAATTTTA] 3'. Expr5234 Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; unidentified cells in tail ;  
Strain: BC11364 [C08B6.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGACGTCGAATGTTTCCTTG] 3' and primer B 5' [TAGAGTGTAGAGATTGCGCGTC] 3'. Expr5206 Adult Expression: pharynx; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC15491 [C06G3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAATTTTTGTAGAAAGTGTGGG] 3' and primer B 5' [TTTGTCGATTTTGAACTTGGG] 3'. Expr5192 Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC16156 [C05D11.7b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATATGATGTTTTGTGTGCG] 3' and primer B 5' [GTGATTTTCTGGAAAAGAACAAAA] 3'. Expr5175 Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC15051 [ife-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACAGCTAATTGCGAAGAATGAA] 3' and primer B 5' [ACGTTTCAGCTTCGATCTCTG] 3'. Expr5177 Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;  
Strain: BC14237 [C03H5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCATTTTCCATTTTCGTC] 3' and primer B 5' [TCGTTAGCTCGATTGATGG] 3'. Expr5136 Adult Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;  
Also expressed in (comments from author) : Mosaic population. Strain: BC11019 [ost-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCAATAAACAAAACACATCTGG] 3' and primer B 5' [GACGGCGAATGAAGAGGA] 3'. Expr5494 Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head;  
Strain: BC15358 [rpl-34::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCGATGAGACATTTCCGA] 3' and primer B 5' [TAACGCGGAGGGAGATTTTT] 3'. Expr5485 Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons;  
Strain: BC14075 [uvt-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAAAATTCGCAAACAAGTGGAA] 3' and primer B 5' [TGAGCTATGTCGATTGTTGGAC] 3'. Expr5488 Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ;  
Also expressed in (comments from author) : Mosaic population. Strain: BC14164 [C37C3.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'. Expr5460 Adult Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; head mesodermal cell; Nervous System; neurons along body; Larval Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; body wall muscle; head mesodermal cell; Nervous System; neurons along body;  
Also expressed in (comments from author) : No comments. Strain: BC14988 [lin-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACCAACTTCAAATGGTCAGAA] 3' and primer B 5' [ACTGTAGAGTGTCGGCGCTT] 3'. Expr5464 Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; Larval Expression: anal depressor muscle; body wall muscle;  
Strain: BC11970 [C37C3.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'. Expr5459 Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; coelomocytes; unidentified cells in body ; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; coelomocytes; unidentified cells in body ;  
Also expressed in (comments from author) : No comments. Strain: BC15498 [C34F11.3b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTTCACGCCTCACTCAG] 3' and primer B 5' [GTGTCTTCGGGATTCTTCCTATAA] 3'. Expr5423 Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC14919 [dpf-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACCTGGTCTCGACACATTTT] 3' and primer B 5' [ATCATTCTCCATTTTTCGAAACTC] 3'. Expr5353 Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; head mesodermal cell; seam cells; unidentified cells in head; Larval Expression: anal depressor muscle; head mesodermal cell; seam cells; unidentified cells in head;  
Strain: BC15292 [C25A1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTGTTCCACTCATCTCTTCG] 3' and primer B 5' [TATCCCGATATTTTCCACTGAAAT] 3'. Expr5333 Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca uterine valve; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons;  
Strain: BC10157 [B0303.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATTCCTTTGACGAATTGTA] 3' and primer B 5' [CCGGTGATCTGAATACACACA] 3'. Expr5044 Adult Expression: pharynx; Reproductive System; uterine muscle; vulval muscle; body wall muscle; Larval Expression: pharynx; intestine; body wall muscle;  
Also expressed in (comments from author) : No comments. Strain: BC14670 [B0272.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACACCTTCTGAACATTTTGG] 3' and primer B 5' [AAGTTGAACTGAGGATTCTGCAA] 3'. Expr5032 Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; seam cells; Nervous System; neurons along body; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; seam cells; Nervous System; neurons along body;  
Strain: BC14419 [Y73E7A.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCCAGACTTTGATTGCG] 3' and primer B 5' [TGTGATCTGGAAAGTTCGTTTTT] 3'. Expr7119 Adult Expression: Reproductive System; uterine muscle; vulval muscle; body wall muscle; Larval Expression: body wall muscle; Nervous System; ventral nerve cord; head neurons;  
Strain: BC13624 [Y71F9B.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGGTCAAAACCCACTTCTCA] 3' and primer B 5' [GCGCTGGAAAATTGGATG] 3'. Expr7108 Adult Expression: pharynx; rectal gland cells; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; rectal gland cells; anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ;  
Operon: CEOP1056   Expr9464 Adult Expression: pharynx; rectal gland cells; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons. Larval Expression: pharynx; rectal gland cells; anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ; Sub-cellular localization within the body wall muscle: Muscle cell membrane +/- Muscle arms
Strain: BC15529 [Y71F9AL.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGGACACCAAAAAGTCAAA] 3' and primer B 5' [TTCCTTTGGTGCGATTTTTC] 3'. Expr7107 Adult Expression: pharynx; stomato-intestinal muscle; uterine muscle; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; Larval Expression: pharynx; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons;  
Also expressed in (comments from author) : ubiquitous expression Strain: BC14337 [erd-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAATGGCAATTGAACTCCG] 3' and primer B 5' [TCTGCGTTATGGAAGAACAGAA] 3'. Expr5691 Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ;  
Strain: BC14781 [F08G12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGTTCTAAGTTTTATGCGGTT] 3' and primer B 5' [TTGCGGAGAAGATCTGAATAATTT] 3'. Expr5689 Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body;  
Strain: BC10749 [slo-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGTATCACAAAAGCGTAAAAGC] 3' and primer B 5' [TGTCGTCCGAGATTTTTGC] 3'. Expr5677 Adult Expression: Reproductive System; uterine muscle; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC14696 [F08C6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGATCAACTCGAAGCATATTGA] 3' and primer B 5' [CGAGGGATTATTTGTGCTGAA] 3'. Expr5679 Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; developing uterus; developing spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  
Strain: BC13861 [let-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACAGATATGAACGGTGGAATTT] 3' and primer B 5' [TCGTTGCTTCATGGTGGTAG] 3'. Expr5656 Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; head mesodermal cell; Nervous System; head neurons; unidentified cells in head; Larval Expression: anal depressor muscle; distal tip cell; head mesodermal cell; Nervous System; head neurons; unidentified cells in head;  

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage after an hermaphrodite animal is fully-developed and reaches maturity. adult hermaphrodite Ce WBls:0000057

3 Parents

Definition Name Synonym Primary Identifier
An apparatus for laying eggs of the hermaphrodite reproductive system, consists of the uterus, the uterine muscles, the vulva, the vulval muscles, and a local neuropil formed by the egg-laying neurons. egg-laying apparatus   WBbt:0008587
cells or anatomical parts specific to the hermaphrodite sex hermaphrodite-specific anatomical entity   WBbt:0005758
  smooth muscle   WBbt:0005781