WormMine: AnatomyTerm WBbt:0005342

• Definition: muscle lining of the uterine wall.
• Name: uterine muscle
• Primary Identifier: WBbt:0005342

2 Children

Definition	Name	Synonym	Primary Identifier
Set two type of uterine muscle.	um2	uterine muscle, type 2	WBbt:0006916
Set one type of uterine muscle.	um1	uterine muscle, type 1	WBbt:0006915

3 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Single-cell RNA-Seq cell group 7_2 expressed in muscle.	scVI 0.6.0	WBPaper00065841:7_2
	Single-cell RNA-Seq cell group 7_4 expressed in muscle.	scVI 0.6.0	WBPaper00065841:7_4
	Single-cell RNA-Seq cell group 59 expressed in: Uterine muscle .	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:59

153 Expression Patterns

• Primary Identifier: Expr4809
• Remark: Picture: Figure 8. Staining was greatly reduced in unc-87(e843).
• Pattern: The antibody react with body wall muscle, pharyngeal muscle, anal depressor and sphincter muscle, intestinal muscles, vulval muscles and uterine muscles. In all cases, UNC-87 was contained withing the pattern observed with phalloidin or anti-actin antibodies, suggesting colocalization with thin filaments..
• Subcellular Localization: Immunohistochemical staining of wild type adult body wall muscle revealed a atriated pattern. The striations are interupted periodically along their length by unstained regions. Double labelling experiments showed that anti-UNC-87 staining pattern corresponded with that of the monoclonal antibody MH44. This pattern represent the I band. At the center of the I band are the dense bodies, these correspond to the unstained regions within the striations.

• Primary Identifier: Expr4264
• Pattern: Expressed in body wall muscle cells, pharyngeal muscles, rectal gland cells, vulval and uterine muscles, and a subset of neurons in the head and ventral nerve cord. The expression was first detected in the embryo at the 1.5-fold stage and continued to be expressed until adulthood. In this stage, cells with position corresponding to P cells showed also GFP expression. In order to determine if the expression of GFP was in epidermal lineages, including P cells and their descendants, authors prepared double transgenic lines expressing GFP from promoter 1 of nhr-40 on the background of SU93 line that expresses an AJM::GFP membrane marker. This confirmed the expression of nhr-40::gfp in epidermal precursors P cells and their neuronal progeny within the ventral neuronal cord. However, the GFP was not observed in ventral epidermal cells that originated from P cells. The nhr-40::gfp was not observed in seam cells that are also marked by an AJM::GFP. The muscle pattern of expression was partially lost with truncations of this promoter fragments (-1013 and -682 bp); however, other aspects of expression were retained.

• Primary Identifier: Expr4663
• Pattern: ppk-1::GFP expression was observed in such somatic tissues as gonad sheath and spermatheca, distal tip cells, and uterine and vulva muscles. ppk-1::GFP also showed extensive expression in such neuronal cells as ventral nerve cord, neuronal cell bodies near the nerve ring, and tail neurons.

• Primary Identifier: Expr4547
• Reporter Gene: For dre-1::gfp, a 4 kb promoter was amplified with primers 5' -GGTACCCGAGGGGACATCGAGATAG-3' and 5' -GGTACCTTCCTGGCCAACCAGAGAC-3' and was cloned into Fire vector L3781 (BA 279). The dre-1 ORF and the dre-1 3' UTR region were amplified with primers 5' -GCTAGCATGTCGTCCTCTTCGTCAC-3' and 5' -ACTAGTTACTTACTCCACTCCACACAG-3' and were cloned into BA279 (BA280). Lines containing this construct included dhEx346 and dhIs442. To obtain the full-length promoter construct, authors substituted the promoter from BA279 with a 12.3 kb promoter by using primers 5' -GCGGCCGCGTTGCACACAAAACATTATTATTTTCTTTCTCTT-3' and 5' -TACGTATCTCGTCCCTGAGATCTCTCATTT-3' (BA508). Resulting lines containing this array included dhEx443 and dhEx452. --precise ends.
• Pattern: First detected by midembryogenesis, expression was most prominent in epidermal and intestinal cells. By the 1.5-fold stage of embryogenesis, expression was additionally detected in neurons and other cells. During larval and adult stages, DRE-1::GFP was most visible in epidermal seam cells and hypodermis. Expression was high in larvae and low in adults. In addition, DRE-1 was strongly expressed in the P epidermal blast cells and descendents that give rise to the vulva. Weak expression was seen in the somatic gonad, including the gonadoblasts, the anchor cell, dtcs, and occasionally adult spermatheca and uterus. Notably, with another construct (dhEx346, 4 kb promoter, 4 kb coding region), dtc expression was stronger and commenced by mid-L3. In the musculature, DRE-1 was seen in the pharynx, anal depressor, sex muscles, and body wall muscles. Finally, DRE-1 was detected in neurons of the head, tail, ventral cord, and periphery.
• Subcellular Localization: Generally, DRE-1::GFP was localized to both the nucleus and cytoplasm, and it was broadly expressed, including in phenotypically affected tissues.

• Primary Identifier: Expr5234
• Remark: Strain: BC14107
• Reporter Gene: [C10G8.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTAATTCTCCAGAATCGCAACT] 3' and primer B 5' [TATCGAGCCCTACGGAATTTTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; unidentified cells in tail

• Primary Identifier: Expr5206
• Remark: Strain: BC11364
• Reporter Gene: [C08B6.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGACGTCGAATGTTTCCTTG] 3' and primer B 5' [TAGAGTGTAGAGATTGCGCGTC] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5192
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15491
• Reporter Gene: [C06G3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAATTTTTGTAGAAAGTGTGGG] 3' and primer B 5' [TTTGTCGATTTTGAACTTGGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr5175
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16156
• Reporter Gene: [C05D11.7b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATATGATGTTTTGTGTGCG] 3' and primer B 5' [GTGATTTTCTGGAAAAGAACAAAA] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5177
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15051
• Reporter Gene: [ife-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACAGCTAATTGCGAAGAATGAA] 3' and primer B 5' [ACGTTTCAGCTTCGATCTCTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5136
• Remark: Strain: BC14237
• Reporter Gene: [C03H5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCATTTTCCATTTTCGTC] 3' and primer B 5' [TCGTTAGCTCGATTGATGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5494
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11019
• Reporter Gene: [ost-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCAATAAACAAAACACATCTGG] 3' and primer B 5' [GACGGCGAATGAAGAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head

• Primary Identifier: Expr5485
• Remark: Strain: BC15358
• Reporter Gene: [rpl-34::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCGATGAGACATTTCCGA] 3' and primer B 5' [TAACGCGGAGGGAGATTTTT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5488
• Remark: Strain: BC14075
• Reporter Gene: [uvt-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAAAATTCGCAAACAAGTGGAA] 3' and primer B 5' [TGAGCTATGTCGATTGTTGGAC] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5460
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14164
• Reporter Gene: [C37C3.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; head mesodermal cell; Nervous System; neurons along body; Larval Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; body wall muscle; head mesodermal cell; Nervous System; neurons along body

• Primary Identifier: Expr5464
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14988
• Reporter Gene: [lin-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACCAACTTCAAATGGTCAGAA] 3' and primer B 5' [ACTGTAGAGTGTCGGCGCTT] 3'.
• Pattern: Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; Larval Expression: anal depressor muscle; body wall muscle

• Primary Identifier: Expr5459
• Remark: Strain: BC11970
• Reporter Gene: [C37C3.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; coelomocytes; unidentified cells in body ; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; coelomocytes; unidentified cells in body

• Primary Identifier: Expr5423
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15498
• Reporter Gene: [C34F11.3b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTTCACGCCTCACTCAG] 3' and primer B 5' [GTGTCTTCGGGATTCTTCCTATAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5353
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14919
• Reporter Gene: [dpf-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACCTGGTCTCGACACATTTT] 3' and primer B 5' [ATCATTCTCCATTTTTCGAAACTC] 3'.
• Pattern: Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; head mesodermal cell; seam cells; unidentified cells in head; Larval Expression: anal depressor muscle; head mesodermal cell; seam cells; unidentified cells in head

• Primary Identifier: Expr5333
• Remark: Strain: BC15292
• Reporter Gene: [C25A1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTGTTCCACTCATCTCTTCG] 3' and primer B 5' [TATCCCGATATTTTCCACTGAAAT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca uterine valve; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5044
• Remark: Strain: BC10157
• Reporter Gene: [B0303.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATTCCTTTGACGAATTGTA] 3' and primer B 5' [CCGGTGATCTGAATACACACA] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; uterine muscle; vulval muscle; body wall muscle; Larval Expression: pharynx; intestine; body wall muscle

• Primary Identifier: Expr5032
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14670
• Reporter Gene: [B0272.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACACCTTCTGAACATTTTGG] 3' and primer B 5' [AAGTTGAACTGAGGATTCTGCAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; seam cells; Nervous System; neurons along body; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; seam cells; Nervous System; neurons along body

• Primary Identifier: Expr7119
• Remark: Strain: BC14419
• Reporter Gene: [Y73E7A.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCCAGACTTTGATTGCG] 3' and primer B 5' [TGTGATCTGGAAAGTTCGTTTTT] 3'.
• Pattern: Adult Expression: Reproductive System; uterine muscle; vulval muscle; body wall muscle; Larval Expression: body wall muscle; Nervous System; ventral nerve cord; head neurons

• Primary Identifier: Expr7108
• Remark: Strain: BC13624
• Reporter Gene: [Y71F9B.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGGTCAAAACCCACTTCTCA] 3' and primer B 5' [GCGCTGGAAAATTGGATG] 3'.
• Pattern: Adult Expression: pharynx; rectal gland cells; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; rectal gland cells; anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr9464
• Remark: Operon: CEOP1056
• Pattern: Adult Expression: pharynx; rectal gland cells; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons. Larval Expression: pharynx; rectal gland cells; anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Muscle cell membrane +/- Muscle arms

• Primary Identifier: Expr7107
• Remark: Strain: BC15529
• Reporter Gene: [Y71F9AL.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGGACACCAAAAAGTCAAA] 3' and primer B 5' [TTCCTTTGGTGCGATTTTTC] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; uterine muscle; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; Larval Expression: pharynx; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons

• Primary Identifier: Expr5691
• Remark: Also expressed in (comments from author) : ubiquitous expression Strain: BC14337
• Reporter Gene: [erd-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAATGGCAATTGAACTCCG] 3' and primer B 5' [TCTGCGTTATGGAAGAACAGAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5689
• Remark: Strain: BC14781
• Reporter Gene: [F08G12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGTTCTAAGTTTTATGCGGTT] 3' and primer B 5' [TTGCGGAGAAGATCTGAATAATTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body

• Primary Identifier: Expr5677
• Remark: Strain: BC10749
• Reporter Gene: [slo-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGTATCACAAAAGCGTAAAAGC] 3' and primer B 5' [TGTCGTCCGAGATTTTTGC] 3'.
• Pattern: Adult Expression: Reproductive System; uterine muscle; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5679
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14696
• Reporter Gene: [F08C6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGATCAACTCGAAGCATATTGA] 3' and primer B 5' [CGAGGGATTATTTGTGCTGAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; developing uterus; developing spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5656
• Remark: Strain: BC13861
• Reporter Gene: [let-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACAGATATGAACGGTGGAATTT] 3' and primer B 5' [TCGTTGCTTCATGGTGGTAG] 3'.
• Pattern: Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; head mesodermal cell; Nervous System; head neurons; unidentified cells in head; Larval Expression: anal depressor muscle; distal tip cell; head mesodermal cell; Nervous System; head neurons; unidentified cells in head

1 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage after an hermaphrodite animal is fully-developed and reaches maturity.		adult hermaphrodite Ce	WBls:0000057

3 Parents

Definition	Name	Synonym	Primary Identifier
An apparatus for laying eggs of the hermaphrodite reproductive system, consists of the uterus, the uterine muscles, the vulva, the vulval muscles, and a local neuropil formed by the egg-laying neurons.	egg-laying apparatus		WBbt:0008587
cells or anatomical parts specific to the hermaphrodite sex	hermaphrodite-specific anatomical entity		WBbt:0005758
	smooth muscle		WBbt:0005781