WormMine: ExpressionPattern Expr6991

• Pattern: Adult Expression: Reproductive System; uterus; vulval muscle; Nervous System; ventral nerve cord; tail neurons; unidentified cells in body ; Larval Expression: Reproductive System; developing uterus; Nervous System; ventral nerve cord; tail neurons; unidentified cells in body
• Primary Identifier: Expr6991
• Remark: Strain: BC11356
• Reporter Gene: [Y47G6A.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCAGGGTGTCCCTTTCT] 3' and primer B 5' [GATTAAATGGACAAGTTGCTGTG] 3'.

7 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
	reproductive system		WBbt:0005747
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00021637	Y47G6A.7	Y47G6A.7	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023