WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: rectal epithelium; excretory cell; unidentified cells in tail ; Larval Expression: rectal epithelium; hypodermis; unidentified cells in tail ; Primary Identifier  Expr6629
Remark  Strain: BC14804 Reporter Gene  [T07D4.4a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCTCCAACTTCTTCTCCTCG] 3' and primer B 5' [TACCCCAATCAGCGATTTTC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
posterior region, from rectum to the end tail   WBbt:0005741
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00011580 ddx-19 T07D4.4 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023