WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; Reproductive System; spermatheca; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; excretory cell; unidentified cells in tail ; Primary Identifier  Expr6121
Remark  Strain: BC14890 Reporter Gene  [rpn-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTGAATAACCAAGAACATAACCA] 3' and primer B 5' [GCCTCTGTGATCCTCCTTAAAAT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

5 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
posterior region, from rectum to the end tail   WBbt:0005741
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004463 rpn-7 F49C12.8 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023