WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulval muscle; hypodermis; Nervous System; head neurons; amphids; unidentified cells in head; Larval Expression: Nervous System; head neurons; amphids; unidentified cells in head; Primary Identifier  Expr6124
Remark  Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11997 Reporter Gene  [sra-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTGTTTTCGAATCGGTTACTG] 3' and primer B 5' [GAGGAAGGAGTTGCGATATTTTT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

7 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron of the amphid sensillum amphid neuron amphid sensory neuron WBbt:0005394
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00005039 sra-13 F49E12.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023