WormMine: Gene WBGene00005039

• WormBase Gene ID: WBGene00005039
• Gene Name: sra-13
• Sequence Name: F49E12.5
• Brief Description: sra-13 encodes a seven transmembrane G protein-coupled chemosensory receptor; SRA-13 functions together with the GPA-5 G protein alpha subunit to negatively regulate RAS/MAPK signaling during vulval induction and sensation of volatile attractants; sra-13 activity is required for suppression of vulval induction in response to starvation; sra-13 reporter fusions are expressed in the AWAL/R and AWCL/R chemosensory neurons as well as in muscle and hypodermal cells.
• Organism: Caenorhabditis elegans
• Automated Description: Enables olfactory receptor activity. Involved in several processes, including detection of chemical stimulus involved in sensory perception of smell; negative regulation of Ras protein signal transduction; and negative regulation of vulval development. Predicted to be located in membrane. Expressed in amphid neurons; body wall musculature; head; hypodermis; and muscle cell.
• Biotype: SO:0001217
• Genetic Position: II :0.772033 ±0.000415
• Length (nt): 1553

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00005039

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F49E12.5b.1	F49E12.5b.1	827	II: 8407685-8409211
Transcript:F49E12.5a.1	F49E12.5a.1	1008	II: 8407730-8409237

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F49E12.5b	F49E12.5b	525	II: 8407685-8407975
CDS:F49E12.5a	F49E12.5a	1008	II: 8407730-8407975

3 RNAi Result

• WBRNAi00047853
• WBRNAi00015320
• WBRNAi00032540

22 Allele

• gk963801
• gk963053
• gk962682
• gk963446
• WBVar01604308
• WBVar01559638
• zh13
• WBVar01242293
• gk474090
• gk441995
• gk651665
• gk795856
• WBVar00104658
• gk406480
• gk704699
• WBVar00173977
• gk148834
• gk148833
• WBVar00173976
• gk668796
• WBVar00268858
• gk503695

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00005039
• Start: 8407685
• End: 8409237
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_8409238..8412670
• Length (nt): 3433
• Chromosome Location: II: 8409238-8412670
• Organism: Caenorhabditis elegans

27 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
Bacteria infection: Serratia marcescens	Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray
EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food.	Genes differentially expressed under EtBr treatment without UVC exposure vs after UVC exposure but without EtBr treatment at the -3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food).	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:EtBr-exposed_vs_UVC-exposed_51h
	Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-2(e1370)_upregulated_neuron
	Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-16(mu86)_upregulated_neuron
	Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
Hypoxia: 7% oxygen.	Transcripts that showed significantly increased expression at animals treated with 7% oxygen, comparing to animals grown at 21% oxygen.	Fold change > 2, p-value < 0.05.	WBPaper00060661:hypoxia_upregulated
Bacteria infection: Photorhabdus luminescens	Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:P.lumniescens_24hr_upregulated_TilingArray
Fungi infection: Drechmeria coniospora	Genes with decreased expression after 12 hours of infection by D.coniospora Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:D.coniospora_12hr_downregulated_RNAseq
	Transcripts that showed significantly increased expression in alg-1(gk204) comparing to in N2 at 5-days post L4 adult hermaphrodites.	DESeq, fold change > 2, adjusted p-value < 0.05.	WBPaper00054758:alg-1(gk204)_upregulated
	Transcripts that showed significantly increased expression in sensory neuron (labeled by iaIs25[Pgcy-37::GFP + unc-119(+)]) comparing to in whole worm.	Fold change > 2, p-value < 0.05.	WBPaper00060661:sensory-neuron_enriched
	Transcripts that showed significantly increased expression in 24-cell stage embryo of chd-3(eh4)let-418(RNAi) animals, comparing to in N2 animals injected with gfp control RNAi vector.	DESeq and EdgeR were used. A threshold of 1.5 log2 fold change and a p value <10 % were applied. let-418: wild-type; let-418(RNAi)-treated embryos; chd-3: chd-3(eh4);controlGFP(RNAi)-treated embryos; chd-3_let-418: chd-3(eh4); let-418(RNAi)-treated embryos. All fold changes are calculated versus wild-type;control(RNAi)-treated embryos. 1h and 3h correspond to the 24- and 100-cell stages, respectively.	WBPaper00050163:chd-3(eh4);let-418(RNAi)_upregulated_100-cell-embryo
	Top 300 transcripts enriched in ABalaaaarl, ABalaaaarr according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:RME_LR_parent
	Transcripts that showed significantly increased expression in drh-3(rrr2) comparing to in N2.	edgeR, log2 fold change > 2 or < -2.	WBPaper00053888:drh-3(rrr2)_upregulated
	Top 300 transcripts enriched in ABplpppaapa, ABprpppaapa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Neuroblast_PVC_LUA
	Proteins interacting with ELKS-1 according to TurboID-based enzymatic protein labeling and extraction of biotinylated proteins.	N.A.	WBPaper00061818:ELKS-1_interacting
	Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:srj-21-srh-32
	Single-cell RNA-Seq cell group 77_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:77_0
	Single-cell RNA-Seq cell group 99_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:99_0

9 Expression Patterns

• Primary Identifier: Expr2034365
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6124
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11997
• Reporter Gene: [sra-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTGTTTTCGAATCGGTTACTG] 3' and primer B 5' [GAGGAAGGAGTTGCGATATTTTT] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; hypodermis; Nervous System; head neurons; amphids; unidentified cells in head; Larval Expression: Nervous System; head neurons; amphids; unidentified cells in head

• Primary Identifier: Expr6125
• Remark: Also expressed in (comments from author) : AWA + AWC amphid neurons (Thomas Lab 2005). Embryo incomplete. To be updated. Strain: BC13517
• Reporter Gene: [sra-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTGTTTTCGAATCGGTTACTG] 3' and primer B 5' [GAGGAAGGAGTTGCGATATTTTT] 3'.
• Pattern: Adult Expression: hypodermis; seam cells; Nervous System; head neurons; amphids; Larval Expression: hypodermis; seam cells; Nervous System; head neurons; amphids

• Primary Identifier: Expr2611
• Pattern: Both gfp reporter transgenes showed strong expression in two bilaterally symmetric pairs of neurones in the head of the animal. These neurones was identified as the AWAL/R and AWCL/R chemosensory neurones. In addition to the four chemosensory neurones, the transcriptional fusion was expressed in muscle and hypodermal cells throughout the animal. The expression of SRA-13 in the chemosensory neurones suggested that, like the other SRA proteins, SRA-13 might be involved in sensing the environment.
• Subcellular Localization: In the AWA and AWC neurones, the translational SRA-13::GFP fusion protein was present in the cell body, the axons and the dendrites.

• Primary Identifier: Expr14001
• Pattern: ADL, ASI, ASJ (in Wormbase another sra-11 reporter is annotated as being expressed in AWC, AWA, hypodermis, body wall muscle, vulval muscle, seam cells)

• Primary Identifier: Expr1151687
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2016130
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1015667
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1384
• Remark: Original chronogram file: chronogram.263.xml
• Reporter Gene: [F49E12.5:gfp] transcriptional fusion.

15 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00005039
• Start: 8407685
• End: 8409237
• Strand: 1

15 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1553

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00002624
• WBStrain00001978
• WBStrain00000143

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_8406928..8407684
• Length (nt): 757
• Chromosome Location: II: 8406928-8407684
• Organism: Caenorhabditis elegans