WormMine: ExpressionPattern Expr6046

• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; hypodermis; Nervous System; tail neurons; unidentified cells in head; Larval Expression: pharynx; hypodermis; Nervous System; tail neurons; unidentified cells in head
• Primary Identifier: Expr6046
• Remark: Strain: BC12103
• Reporter Gene: [mkk-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGATGAACTGAAACGAAACATTG] 3' and primer B 5' [TCTTCTTGAACGATTAACTCTGAA] 3'.

8 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003368	mkk-4	F42G10.2	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023