WormMine: ExpressionPattern Expr6936

• Pattern: Adult Expression: Nervous System; nerve ring; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids; unidentified cells in head; Larval Expression: Nervous System; nerve ring; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids; unidentified cells in head
• Primary Identifier: Expr6936
• Remark: Strain: BC13105
• Reporter Gene: [Y37E3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGCCGAATCTCAATTTTTACT] 3' and primer B 5' [CTTTTCGGTGATTTCTTCTCACTT] 3'.

8 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neurons that sense body touch, have specialized microtubules in processes.	touch receptor neuron	microtubule cell	WBbt:0005237
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
neuron of phasmid sensillum	phasmid neuron		WBbt:0006753
neuron of the amphid sensillum	amphid neuron	amphid sensory neuron	WBbt:0005394
anterior-most body region containing the pharynx.	head		WBbt:0005739

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00021349	arl-13	Y37E3.5	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023