WormMine: Gene WBGene00021349

• WormBase Gene ID: WBGene00021349
• Gene Name: arl-13
• Sequence Name: Y37E3.5
• Brief Description: arl-13 encodes the ortholog of human Arl13b which encodes the small ciliary G protein, adenosine diphosphate ribosylation factor-like protein; arl-13 is required for normal ciliary morphology and function and intraflagellar transport (IFT), arl-13 functions with the small GTPase, arl-3 for the stability of the IFT complex; arl-13 also interacts genetically with IFT-related genes like nphp-4, klp-11, bbs-8 and dyf-5 to maintain ciliary structure and anterograde IFT; ARL-13 is expressed in ciliated sensory neurons in the proximal ciliary regions and associates with the ciliary membrane via palmitoyl anchors.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Involved in cilium organization; receptor localization to non-motile cilium; and sensory perception of chemical stimulus. Acts upstream of or within motile cilium assembly. Located in plasma membrane bounded cell projection. Expressed in ciliated neurons and head. Used to study Joubert syndrome. Human ortholog(s) of this gene implicated in Joubert syndrome 8. Is an ortholog of human ARL13B (ADP ribosylation factor like GTPase 13B).
• Biotype: SO:0001217
• Genetic Position: I :-12.0683 ±0.035686
• Length (nt): 3407

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00021349

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y37E3.5b.1	Y37E3.5b.1	1206	I: 2065692-2069094
Transcript:Y37E3.5d.1	Y37E3.5d.1	1192	I: 2065698-2069098
Transcript:Y37E3.5a.1	Y37E3.5a.1	1189	I: 2065718-2069094
Transcript:Y37E3.5c.1	Y37E3.5c.1	1123	I: 2065727-2069049
Transcript:Y37E3.5c.2	Y37E3.5c.2	884	I: 2067184-2069058

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y37E3.5b	Y37E3.5b	1104	I: 2065749-2065816
CDS:Y37E3.5d	Y37E3.5d	558	I: 2068390-2068452
CDS:Y37E3.5a	Y37E3.5a	1113	I: 2065749-2065816
CDS:Y37E3.5c	Y37E3.5c	567	I: 2068390-2068452

1 RNAi Result

• WBRNAi00055938

67 Allele

• gk963902
• gk964159
• gk963630
• gk962777
• tm2322
• WBVar01325883
• WBVar01694540
• WBVar01712266
• WBVar01712265
• WBVar02070495
• gk513
• tm1745
• WBVar00149923
• WBVar00149924
• WBVar00149925
• WBVar00534342
• WBVar01556121
• WBVar01662078
• WBVar01662077
• WBVar01662076
• WBVar01662075
• gk961642
• gk104336
• gk104342
• gk104341
• gk104338
• gk104337
• gk104340
• gk104339
• gk559485

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00021349
• Start: 2065692
• End: 2069098
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

137 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
Bacteria: E.faecalis strain OG1RF	Transcripts that showed significantly increased expression after infection by E. faecalis OG1RF.	Ballgown was used to calculate differential expression of genes using FPKM data and to generate tables with fold change and P values. Genes were shortlisted with a cutoff of 2-fold change and P values of less than 0.05.	WBPaper00059754:E.faecalis_OG1RF_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva.	DESeq2 1.26.0, fold change > 2, FDR < 0.05.	WBPaper00064539:nhr-114(gk849)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite npr-8(ok1439) animals grown at 25C, comparing to in N2 animals.	CuffDiff, fold change > 2.	WBPaper00065096:npr-8(ok1439)_upregulated_Day10_25C
	Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:oocyte_vs_mitosis_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:ubc-9(ne4833)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in pgl-1(ct131) animals (isolated from SS0002[pgl-1(ct131)him-3(e1147)], comparing to in control animals SS1174, at 1-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_pgl-1(ct131)_vs_control_day1-adult
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in animals fed with JM103 bacteria producing Cry5B, comparing to control animals fed with JM103.	ANOVA, p-value < 0.05.	WBPaper00056167:Cry5B_upregulated
	Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:spr-1(ok2144)_upregulated

15 Expression Patterns

• Primary Identifier: Expr2009399
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr15050
• Subcellular Localization: ARL-13::GFP, a well-characterized ciliary membrane marker was restricted to a region distal to the DYF-19::tagRFP and NPHP-4::GFP puncta.

• Primary Identifier: Expr3734
• Subcellular Localization: GFP-tagged Y37E3.5 associate with ciliary axonemes in both head (amphids, labials) and tail (phasmids) neurons, with relatively little localization to cell bodies, axons, or dendrites.

• Primary Identifier: Chronogram1054
• Remark: Original chronogram file: chronogram.2116.xml
• Reporter Gene: [Y37E3.5:gfp] transcriptional fusion.

• Primary Identifier: Expr6936
• Remark: Strain: BC13105
• Reporter Gene: [Y37E3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGCCGAATCTCAATTTTTACT] 3' and primer B 5' [CTTTTCGGTGATTTCTTCTCACTT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids; unidentified cells in head; Larval Expression: Nervous System; nerve ring; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids; unidentified cells in head

• Primary Identifier: Expr3037
• Pattern: The 5' untranslated region directed expression to a small subset of sensory cells that are ciliated. GFP signal was observed in the multiple ciliated amphid neurons in the head and both ciliated phasmid neurons (PHA and PHB) in the tail. Expression was also detected in other ciliated sensory neurons, including the inner and outer labial neurons and male tail ray neurons. GFP fluorescence was also detected in the midbody PDE ciliated neuron and PQR ciliated tail neuron.

• Primary Identifier: Expr9064
• Remark: Picture: Fig 1B, Fig S2A.
• Subcellular Localization: ARL-13::GFP localized robustly to amphid and phasmid cilia. Strikingly, GFP-tagged ARL-13 was absent from the distal singlet segment of the cilium and from the rest of the neuron, including the neuronal cell body, dendrite, and axon. Authors did not observe detectable IFT movement of ARL-13::GFP along the cilium.

• Primary Identifier: Expr14512
• Subcellular Localization: In a wild-type background, ARL-13::GFP localized exclusively to the doublet region in amphid channel and phasmid neurons.

• Primary Identifier: Expr2027635
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018543
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1039317
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr8950
• Remark: Picture: Fig. 1 A.
• Subcellular Localization: Unlike GFP-tagged IFT proteins, which extended 68 m from the ciliary base, ARL-13::GFP signals in amphid/phasmid cilia extended only 34 m. A similar restricted proximal ciliary localization was also observed in male tail ray neuronal cilia. In contrast, although enriched in the proximal region of AWB cilia, ARL-13::GFP localized to the entire AWB cilium, including distal fan membranes, indicating that ARL-13 is not excluded from the distal regions of all nematode cilia.

• Primary Identifier: Expr16118
• Subcellular Localization: In adult hermaphrodites, the cilia membrane-associated protein ARL-13::tagRFP (Caspary et al., 2007; Cevik et al., 2010; Li et al., 2010) was localized to the distal dendrites in both A/PQR.

• Primary Identifier: Expr11469
• Subcellular Localization: C. elegans ARL-13 proximal ciliary domain in amphid and phasmid channel cilia corresponds to the middle segment (MS) and does not include the transition zone (TZ); specifically, ARL-13 is juxtaposed to MKSR-1/B9D1 at the TZ, and OSM-6/IFT52 basal body signals are separated from ARL-13 signals by a 1 mm 'gap', which corresponds to the TZ length.

• Primary Identifier: Expr1159456
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

23 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00021349
• Start: 2065692
• End: 2069098
• Strand: 1

23 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3407

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00036326
• WBStrain00002472

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_2065482..2065691
• Length (nt): 210
• Chromosome Location: I: 2065482-2065691
• Organism: Caenorhabditis elegans