WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: gonad sheath cells; Nervous System; head neurons; amphids; neurons along body; PVT interneuron; tail neurons; Larval Expression: gonad sheath cells; Nervous System; head neurons; amphids; neurons along body; PVT interneuron; Primary Identifier  Expr7084
Remark  Also expressed in (comments from author) : Low intensity GFP in head . Expression in gonad sheath cells is exclusively in pair 5, next to the spermatheca. Strain: BC14376 Reporter Gene  [Y60A3A.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCACAGAACGAATGTTGATT] 3' and primer B 5' [GGGGATTTTGAGGGAAAAAGT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

7 Anatomy Terms

Definition Name Synonym Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
Neuron class of one interneuron, projects along ventral cord to ring. PVT lineage name: ABplpappppa WBbt:0004070
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
neuron of the amphid sensillum amphid neuron amphid sensory neuron WBbt:0005394
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis. gonadal sheath cell   WBbt:0005828

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00013360 tmed-4 Y60A3A.9 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023