WormMine: ExpressionPattern Expr7235

• Pattern: Adult Expression: Reproductive System; vulva other; excretory cell; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: rectal epithelium; Reproductive System; distal tip cell; developing vulva; hypodermis; excretory cell; Nervous System; nerve ring; head neurons; neurons along body; tail neurons
• Primary Identifier: Expr7235
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13661
• Reporter Gene: [ZK637.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCTCGCACTCTCCATTCTT] 3' and primer B 5' [CCTGAACGTTGTTTTGTTTGAA] 3'.

12 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
female genital.	vulva		WBbt:0006748
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	anterior distal tip cell	gon herm dtc A	WBbt:0004520
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	posterior distal tip cell	gon herm dtc P	WBbt:0004506
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
H-shaped cell associated with the excretory system, largest cell in C. elegans.	excretory cell	excretory canal cell	WBbt:0005812
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
epithelium connecting intestine and anus.	rectal epithelium		WBbt:0005800
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00014023	lnkn-1	ZK637.3	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023