WormMine: ExpressionPattern Expr6954

• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; amphid socket cells; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; amphid socket cells; pharyngeal neurons; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr6954
• Remark: Also expressed in (comments from author) : NSM neurons in the head (Hall Lab, 2005). Strain: BC11521
• Reporter Gene: [abt-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTGCTTTGGAATTTCAGGT] 3' and primer B 5' [CAATGCACCGATTCTGAAAA] 3'.

12 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.	pharyngeal-intestinal valve	cardia	WBbt:0005767
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron of the pharyngeal nervous system.	pharyngeal neuron		WBbt:0005439
Amphid socket cell, left	AMsoL	lineage name: ABplpaapapa	WBbt:0003931
Amphid socket cell, right	AMsoR	lineage name: ABprpaapapa	WBbt:0003929
posterior region, from rectum to the end	tail		WBbt:0005741
	rectal gland cell		WBbt:0005799
anterior-most body region containing the pharynx.	head		WBbt:0005739

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00000022	abt-4	Y39D8C.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023