WormMine: AnatomyTerm WBbt:0005798

• Definition: a saddle-shaped muscle cell that encircles the intestinal-rectal valve
• Name: anal sphincter muscle
• Primary Identifier: WBbt:0005798
• Synonym: lineage name: ABprpppppap

2 Children

Definition	Name	Synonym	Primary Identifier
	anal sphincter muscle male		WBbt:0008387
	anal sphincter muscle hermaphrodite		WBbt:0008388

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Top 300 transcripts enriched in anal sphincter muscle according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:mu_sph
	Single-cell RNA-Seq cell group 102_0 expressed in muscle.	scVI 0.6.0	WBPaper00065841:102_0

160 Expression Patterns

• Primary Identifier: Expr4852
• Pattern: A-class motor neuron: enriched in larva (1.8); not expressed in embryo. Neuronal expression include: All ventral cord motor neurons, head and tail neurons, touch neurons. Also expressed in other cells: Body muscle, anal depressor, sphincter muscle? Excretory gland cells?. Pan-neuronal: enriched in larva (3.2); not expressed in embryo.

• Primary Identifier: Expr4809
• Remark: Picture: Figure 8. Staining was greatly reduced in unc-87(e843).
• Pattern: The antibody react with body wall muscle, pharyngeal muscle, anal depressor and sphincter muscle, intestinal muscles, vulval muscles and uterine muscles. In all cases, UNC-87 was contained withing the pattern observed with phalloidin or anti-actin antibodies, suggesting colocalization with thin filaments..
• Subcellular Localization: Immunohistochemical staining of wild type adult body wall muscle revealed a atriated pattern. The striations are interupted periodically along their length by unstained regions. Double labelling experiments showed that anti-UNC-87 staining pattern corresponded with that of the monoclonal antibody MH44. This pattern represent the I band. At the center of the I band are the dense bodies, these correspond to the unstained regions within the striations.

• Primary Identifier: Expr4742
• Pattern: The anti-CeTNI-2 antibody strongly stained the body wall muscle, and faintly the pharyngeal muscle, vulval muscles and anal muscles.
• Subcellular Localization: At high magnification the anti-CeTNI-2 antibody stained the thin filaments in the I-band regions that also contain actin.

• Primary Identifier: Expr4740
• Remark: Reporter gene fusion type not specified.
• Pattern: The tni-2 and tni-3 genes were also expressed in the same cells of body wall, vulval and anal muscles, but while tni-2 was uniformly expressed in body wall muscles, the tni-3 gene was strongly expressed in the head, vulval and anal muscles. Expression of tni-2::gfp was observed in the vulval and anal muscles in addition to those muscles detected with tni-2::lacZ. This was the result of the inclusion of a longer 5' upstream region of tni-2 that includes the NdE-box enhancer for vulval expression.

• Primary Identifier: Expr4741
• Remark: Reporter gene fusion type not specified.
• Pattern: The tni-2 and tni-3 genes were also expressed in the same cells of body wall, vulval and anal muscles, but while tni-2 was uniformly expressed in body wall muscles, the tni-3 gene was strongly expressed in the head, vulval and anal muscles. Expression of tni-2::gfp was observed in the vulval and anal muscles in addition to those muscles detected with tni-2::lacZ. This was the result of the inclusion of a longer 5' upstream region of tni-2 that includes the NdE-box enhancer for vulval expression.

• Primary Identifier: Expr4734
• Pattern: A transcriptional arg-1::gfp reporter is expressed in the head mesodermal cell, the vulval muscles, and the enteric muscles.

• Primary Identifier: Expr4943
• Pattern: strong 3-fold emb bwm that fades and becomes mosaic in late L's and adults, vul, anal dep, spinchter, mu int; seam cells in one line at least

• Primary Identifier: Expr4930
• Pattern: strong bwm, vul, anal, rare ant pharynx, bwm precursors, tail hyp, neurons; early embryonic bwm at least by horseshoe stage

• Primary Identifier: Expr4932
• Pattern: strong anal dep, sphinct, vul,; moderate and sporadic bwm; no embryonic seen; re-checked embryonic 6-15 and saw none.

• Primary Identifier: Expr4934
• Pattern: strong bwm, pharyngeal, vul, anal, mu int, sphincter muscles; no embryonic seen

• Primary Identifier: Expr4920
• Pattern: Faint vul, sphincter, anal dep, mu int; faint head neurons; rare spermatheca; bean to L1 see head bwm?- 4 quads of single to double cells GFP+ that don't exactly look like bwm close to bwm position - could be unhappy bwm due to exp?

• Primary Identifier: Expr4924
• Pattern: strong GFP expression in BWM, anal muscle and vulval muscles. GFP visible in late embryo.

• Primary Identifier: Expr4918
• Pattern: Strong vul, bwm, anal, mu int, sphincter, head neurons.

• Primary Identifier: Expr4911
• Remark: Picture: Fig S5.
• Pattern: A transcriptional fusion of the unc-50 promoter to GFP is expressed in all cell types throughout development. unc-50::gfp expression was seen in the head of adult hermaphrodite. Expression is seen in the pharyngeal muscle, head neurons, and epidermis. Expression is also present in the gut, ventral cord motor neurons, and epidermal seam cells. In the mid body region expression is seen in the gut, seam cells, uterus, vulva muscles, and distal tip cell. In the tail region unc-50 expression can be detected in the epidermis and enteric muscles.

• Primary Identifier: Expr4914
• Pattern: Strong GFP expression in BWM, anal muscle and vulval muscles. GFP visible in late embryo.

• Primary Identifier: Expr4379
• Remark: No detailed description on life stages.
• Pattern: ZK795.3::GFP expression pattern includes spermatheca, hypodermal cells, pharynx and the excretory cell and channels. In the L3 stage, expression was seen in the vulva, and in P6.p descendants.

• Primary Identifier: Expr4350
• Pattern: Localized differently within cells and GFP fluorescence was seen in body wall muscle, distal tip cells, enteric muscle and cells of the posterior intestine. Within the pharynx, cca-1 expression is observed in most if not all pharyngeal muscle cells but is most prominent in those of the procorpus and in pm8, the most posterior cell in the terminal bulb.

• Primary Identifier: Expr4340
• Remark: No detailed description on expression pattern in other life stages.
• Pattern: acr-8::GFP was strongly expressed in all body muscle cells as well as in anal and vulval muscles and ventral cord motor neurons. Expression was visible in the embryo.

• Primary Identifier: Expr4559
• Pattern: In the adult, unc-27gfp (bxEx97), a rescuing reporter, is expressed exclusively in body-wall muscles, inner and outer longitudinal muscles, anal depressor, sphincter, and male-specific diagonal muscles. GFP expression is first detected in the 3-fold embryo in embryonic body-wall muscles and is maintained after hatching into the adult stage.

• Primary Identifier: Expr5277
• Remark: Strain: BC15643
• Reporter Gene: [tag-73::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; Reproductive System; vulval muscle; seam cells; Nervous System; head neurons; amphids; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; seam cells; Nervous System; head neurons; amphids

• Primary Identifier: Expr5268
• Remark: Also expressed in (comments from author) : Unidentified in head might be amphid socket cells?Embryo incomplete. To be updated. Strain: BC10468
• Reporter Gene: [C15C7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTTCAAAATTTCGCCTGAAAA] 3' and primer B 5' [TCGGTAGTTGCTGATTTTCACTAT] 3'.
• Pattern: Adult Expression: intestine; anal sphincter; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; Larval Expression: intestine; anal sphincter; rectal epithelium; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head

• Primary Identifier: Expr5269
• Remark: Also expressed in (comments from author) : Pharyngeal neuron is probably I3 (Hall Lab, 2005). Strain: BC11857
• Reporter Gene: [klp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACGAATGACCCACTTCTC] 3' and primer B 5' [CTTTTTCCTTGAAGATTTCCAACT] 3'.
• Pattern: Adult Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head; Larval Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head

• Primary Identifier: Expr5438
• Remark: Strain: BC11960
• Reporter Gene: [ced-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAGGCCTCTCACATTCCTGT] 3' and primer B 5' [TGATGTTTTCGAAACAACGGT] 3'.
• Pattern: Adult Expression: intestine; anal sphincter; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; Larval Expression: intestine; anal sphincter; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons

• Primary Identifier: Expr5338
• Remark: Strain: BC12726
• Reporter Gene: [C26C6.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGACAAATCTCATGGACAAAA] 3' and primer B 5' [TGATTGAGTCTGAAAACGGAAATA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; vulva other; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5056
• Remark: Also expressed in (comments from author) : neural in head may be the Labial Sensilla. Strain shows high intensity GFP, therefore anything neural can be hard to see. Strain: BC10655
• Reporter Gene: [B0336.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATATCAATGAAAACGGTCAATGG] 3' and primer B 5' [ATTGTCGATGTGGATGCTTTC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; Reproductive System; uterine-seam cell; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; labial sensilla; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; labial sensilla; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5031
• Remark: Strain: BC10183
• Reporter Gene: [asm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTATTGAGAACATCATCTGC] 3' and primer B 5' [CCTGATTTCCAGAGTTTCCTG] 3'.
• Pattern: Adult Expression: anal depressor muscle; anal sphincter; Reproductive System; vulval muscle; hypodermis; Nervous System; head neurons; Larval Expression: intestine; anal depressor muscle; anal sphincter; body wall muscle; hypodermis

• Primary Identifier: Expr5099
• Remark: Also expressed in (comments from author) : quite a number of processes in head Strain: BC10874
• Reporter Gene: [erm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAATTTGTTTTGTTTCAGCGTTTC] 3' and primer B 5' [TAGCTCTTTTTGATGTCCGAGTC] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; excretory cell; Nervous System; head neurons; neurons along body; Larval Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; Reproductive System; developing uterus; developing spermatheca; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells

• Primary Identifier: Expr7748
• Remark: Clone: pUL#IAH10D4
• Pattern: A complex, multi-component expression pattern. Expression strongest in vulval muscles, then rectal muscles, then a few nerves in the nerve ring and weakest expression in body wall muscles. Apart from vulval expression, expression seen from late embryo to adult. All 8 lines examined showed same expression pattern but with differences in intensity.

• Primary Identifier: Expr7158
• Remark: Strain: BC11353
• Reporter Gene: [ZC328.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATTTTCGGTATCTGAAGACAA] 3' and primer B 5' [TGTGATTGTCGACGTGGAAG] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; intestine; anal sphincter; unidentified cells in head; Larval Expression: pharyngeal-intestinal valve; intestine; anal sphincter; unidentified cells in head

• Primary Identifier: Expr8970
• Remark: Picture: Fig 7.
• Pattern: GFP expression was observed in several neurons including head neurons, motor neurons located in the ventral nerve cord, HSN and CAN neurons, and tail neurons. However, rep-1 does not seem to be expressed in all the neurons. Not only was GFP involved in the neuronal expression, it was also expressed in various muscles such as body-wall, pharyngeal, intestinal and anal sphincter, in addition to the seam cells, hypodermis and the intestine.

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
Muscle cell of the alimentary canal, excluding the pharynx.	enteric muscle		WBbt:0008600
	smooth muscle		WBbt:0005781