WormMine: ExpressionPattern Expr5099

• Pattern: Adult Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; excretory cell; Nervous System; head neurons; neurons along body; Larval Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; Reproductive System; developing uterus; developing spermatheca; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells
• Primary Identifier: Expr5099
• Remark: Also expressed in (comments from author) : quite a number of processes in head Strain: BC10874
• Reporter Gene: [erm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAATTTGTTTTGTTTCAGCGTTTC] 3' and primer B 5' [TAGCTCTTTTTGATGTCCGAGTC] 3'.

10 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.	pharyngeal-intestinal valve	cardia	WBbt:0005767
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
a saddle-shaped muscle cell that encircles the intestinal-rectal valve	anal sphincter muscle	lineage name: ABprpppppap	WBbt:0005798
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
H-shaped cell associated with the excretory system, largest cell in C. elegans.	excretory cell	excretory canal cell	WBbt:0005812
	rectal gland cell		WBbt:0005799
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00001333	erm-1	C01G8.5	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023