WormMine: ExpressionPattern Expr5269

• Pattern: Adult Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head; Larval Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head
• Primary Identifier: Expr5269
• Remark: Also expressed in (comments from author) : Pharyngeal neuron is probably I3 (Hall Lab, 2005). Strain: BC11857
• Reporter Gene: [klp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACGAATGACCCACTTCTC] 3' and primer B 5' [CTTTTTCCTTGAAGATTTCCAACT] 3'.

11 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
a saddle-shaped muscle cell that encircles the intestinal-rectal valve	anal sphincter muscle	lineage name: ABprpppppap	WBbt:0005798
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
neuron of the pharyngeal nervous system.	pharyngeal neuron		WBbt:0005439
H-shaped cell associated with the excretory system, largest cell in C. elegans.	excretory cell	excretory canal cell	WBbt:0005812
anterior-most body region containing the pharynx.	head		WBbt:0005739
epithelium connecting intestine and anus.	rectal epithelium		WBbt:0005800

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00002220	gcc-1	C15C7.2	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023