WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: rectal epithelium; Reproductive System; vulva other; seam cells; Larval Expression: rectal epithelium; hypodermis; seam cells; Primary Identifier  Expr5287
Remark  Strain: BC13462 Reporter Gene  [nas-37::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATATTGTAGGAGGCAAGTCG] 3' and primer B 5' [TGCAAAATAGAACATCAAGAATCG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

5 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
Epidermal layer. hypodermis epidermis WBbt:0005733
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003553 nas-37 C17G1.6 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023