WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulval muscle; body wall muscle; unidentified cells in head; Embryo Expression: body wall muscle; hypodermis; Larval Expression: body wall muscle; hypodermis; Primary Identifier  Expr5282
Remark  Strain: BC12920 Reporter Gene  [rol-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGAAAACTCGTTCCATCATT] 3' and primer B 5' [GTCGTCATGTACAGGCTGTCT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

5 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004395 rol-3 C16D9.2 Caenorhabditis elegans

3 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching. embryo Ce WBls:0000003
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023