WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Nervous System; tail neurons; phasmids; Larval Expression: Nervous System; tail neurons; phasmids; Primary Identifier  Expr6718
Remark  Strain: BC12045 Reporter Gene  [srab-20::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGCAATGAGCAAAGAATC] 3' and primer B 5' [CGATAGGAAGACATCTGGAACA] 3'.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
neuron of phasmid sensillum phasmid neuron   WBbt:0006753

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00020607 srab-20 T20D4.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023