WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00020607 Gene Name  srab-20
Sequence Name  ? T20D4.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in ganglia and head mesodermal cell. Biotype  SO:0001217
Genetic Position  V :-11.6993 ±0.010599 Length (nt)  ? 1437
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00020607

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T20D4.1.1 T20D4.1.1 1020   V: 3428997-3430433
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T20D4.1 T20D4.1 993   V: 3428999-3429225

2 RNAi Result

WormBase ID
WBRNAi00053619
WBRNAi00018907

118 Allele

Public Name
gk963301
gk963591
gk963553
gk964259
gk964351
gk963850
gk963027
gk962689
gk962688
WBVar01586859
WBVar01586858
WBVar01586860
WBVar01586862
WBVar01586861
WBVar01586864
WBVar01586863
WBVar01586866
WBVar01586865
WBVar01586868
WBVar01586867
WBVar01586869
WBVar01586871
WBVar01586870
WBVar01586873
WBVar01586872
WBVar01586875
WBVar01586874
WBVar01586877
WBVar01586876
WBVar01586879

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00020607 3428997 3430433 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_3430434..3430509   76 V: 3430434-3430509 Caenorhabditis elegans

33 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L1-larva_expressed
Bacteria infection: Serratia marcescens Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVA-neuron_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (Young adult all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:CEP-sheath-cells_Day1-adult_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:pharyngeal-muscle_L1-larva_expressed
Bacteria infection: Serratia marcescens Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:S.marcescens_24hr_upregulated_RNAseq
  Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_downregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure. Small RNAs (21-26nt) that showed significantly increased expression after L4 animals were exposed to P .aeruginosa strain PA14 for 24 hours. DESeq2, FDR < 0.05 WBPaper00056868:P.aeruginosa_upregulated_smallRNA
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_RNAseq
  Transcripts that showed significantly decreased expression in drh-3(rrr2) comparing to in N2. edgeR, log2 fold change > 2 or < -2. WBPaper00053888:drh-3(rrr2)_downregulated
  Transcripts that showed significantly decreased expression in nfki-1(cer1) animals at L4 larva stage, comparing to in N2 animals. Differentially expressed genes between wild type and knockouts were explored using DESeq2 R package (v.1.20.0) considering a threshold of adjusted p value < 0.01. WBPaper00060445:nfki-1(cer1)_downregulated_L4
  Genes that showed significantly increased expression after exposure to adsorbable organic bromine compounds (AOBr) contained in M. aeruginosa batch culture. Differentially expressed genes (DEGs) were identified with a random variance t-test and a significance analysis of microarrays (SAM) test. Genes were considered statistically significant if their p-value was less than 0.05, the false discovery rate less than 0.3, and the fold change compared to control at least <= 0.67 or >=1.5. WBPaper00046853:AOBr_M.aeruginosa-batch-culture_upregulated
  Transcripts that showed significantly decreased expression in dpy-21(e428) comparing to in N2 during L3 stage. DESeq v1.6.3. Fold change > 1.5. WBPaper00050370:dpy-21(e428)_L3_downregulated

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC12046 [srab-20::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGCAATGAGCAAAGAATC] 3' and primer B 5' [CGATAGGAAGACATCTGGAACA] 3'. Expr6720 Adult Expression: Nervous System; tail neurons; phasmids; Larval Expression: Nervous System; tail neurons; phasmids;  
Strain: BC12182 [T20D4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGCAATGAGCAAAGAATC] 3' and primer B 5' [CGATAGGAAGACATCTGGAACA] 3'. Expr6719 Adult Expression: Nervous System; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; tail neurons; phasmids;  
Strain: BC12045 [srab-20::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGCAATGAGCAAAGAATC] 3' and primer B 5' [CGATAGGAAGACATCTGGAACA] 3'. Expr6718 Adult Expression: Nervous System; tail neurons; phasmids; Larval Expression: Nervous System; tail neurons; phasmids;  
    Expr15413    
    Expr14017 PHB (in Wormbase another srab-20 reporter is annotated as PHA-expressed)  
    Expr3131 T20D4.1 was exclusively expressed in a pair of tail phasmid neurons PHAL/R,  
    Expr1157176 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1013351 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00020607 3428997 3430433 1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1437

1 Sequence Ontology Term