WormMine: AnatomyTerm WBbt:0005298

• Definition: ganglion lies beside the nerve ring in the head, just anterior of the retrovesicular ganglion. It contains about 20 interneuron and motorneuron cell bodies that all send their neuronal processes into the ring. The cell bodies are divided into two groups by the intrusion of the excretory duct and canal. The cells are bounded by a basal lamina which physically separates them from the lateral ganglion even though they are adjacent to one another.
• Name: ventral ganglion
• Primary Identifier: WBbt:0005298
• Synonym: ventral ganglia

2 Children

Definition	Name	Synonym	Primary Identifier
ventral ganglion, anterior part.	ventral ganglion (ant)		WBbt:0005266
ventral ganglion, posterior part.	ventral ganglion (post)		WBbt:0005264

0 Expression Clusters

37 Expression Patterns

• Primary Identifier: Expr720
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Prominent staining of the entire nervous system, specially the axonal processes emanating from neuronal cell bodies is observed at all developmental stages. Neuronal processes including axonal and dendrites consistently stains brighter than the cell bodies. Staining is detected in the central neurophil (nerve ring) in the head, the ventral cord consisting of motor neurons along the body length, lateral nerve cords, lumbar commissures and neuronal cell bodies in the tail ganglia. Staining is observed in the six sets of touch receptor neurons ALML, ALMR, PLML, PLMR, AVM and PVM. In the head region, neurons and their axonal and dendritic processes in the anterior ganglia, lateral ganglia, ventral ganglion, retro-vesicular ganglion and the nerve ring consisting of axonal fibres from neurons located in the head and tail ganglia are brightly labeled. Neurons and their axonal processes are stained in the tail, which has a pair of bilaterally symmetric lumbar ganglia, a small dorso-rectal ganglion and the pre-anal ganglion at the posterior end of the ventral cord. Besides the major axonal bundle of the ventral nerve cord, the dorsal nerve cord and a set of lateral cords along the body length are also stained. Muscle cells, intestine and hypodermal cells stain weakly. Staining of the mitotic spindles in C. elegans are clearly visible in embryos and meiotic spindles in the germline cells in the gonad of adult hermaphrodites. Spindles are stained more strongly and non-spindle structures.
• Subcellular Localization: Stained in neuronal processes and cell bodies. Spindles are stained more strongly.

• Primary Identifier: Expr946
• Remark: To compare the transcription pattern of the daf-1 promoter with the whole gene, the gfp cDNA was fused to the terminus of the daf-1 gene in a plasmid that included 2.6 kb of upstream sequence. Despite the fact that this transgene rescued the daf-1 Daf-c mutant phenotype, GFP fluorescence was not detected in rescued animals. Hence, these observations were limited to the daf-1 promoter fusion, which may not represent the expression pattern of the whole daf-1 gene if enhancer elements are present in introns or in 3' sequences.
• Pattern: GFP expression was observed in the head and the developing ventral nerve cord beginning in mid-stage embryos and continuing into adulthood. In the head, GFP was detected in more than twenty neurons in the anterior, lateral, ventral and retrovesicular ganglia. Fluorescent processes terminating at the tip of the head suggest that daf-1 is expressed in sensory neurons and in support cells in the amphids and inner labial sensilla. In the midbody, GFP was expressed in the ALM mechanosensory neurons and the PVT neuron, as well as one additional neuron pair. In the lumbar ganglia of the tail, five cells expressing GFP included phasmid neurons and PLN and PLM mechanosensory neurons. The daf-1 promoter also conferred gfp expression in nonneuronal cells, including a membranous sheath surrounding the distal end of the intestine and in the distal tip cell (DTC) of the gonad. In some lines, GFP was sometimes detected in the muscles of L4 and adult animals. In L1 larvae, daf-1 promoters is active in neurons in the head, as well as in the ventral cord and tail. The promoter continues to express GFP in dauer larvae from starved plates.

• Primary Identifier: Expr14072
• Remark: Other Strain: OH14294
• Pattern: ASI, ASJ, 1 pair in ventral ganglion, other dim signal in the background (pharynx, muscle, neurons). Variable. Sometimes you see neurons in VNC.

• Primary Identifier: Expr14155
• Remark: Other Strain: OH13882
• Pattern: ASK, ASI, ASH, 1 very bright pair in front of ASK, I neuronal pair in ventral ganglion, PHB, PVT - variable

• Primary Identifier: Expr14181
• Remark: Other Strain: OH13874
• Pattern: ASI, 1 pair of inter/motorneurons in ventral ganglion, sometimes other neurons - variable, PVT

• Primary Identifier: Expr14232
• Remark: Other Strain: OH14401
• Pattern: ASI, one pair below ASI, one pair in ventral ganglion, pharynx, posterior gut, PVT, a bit variable

• Primary Identifier: Expr12512
• Pattern: unc-87A expression. The 2-kb upstream sequence from exon 1A (Punc-87A::GFP), which is entirely downstream of exon 1B, promoted expression of GFP in the pharynx, anal depressor muscle, uterine muscle, vulva, and unidentified neurons in the head and the ventral region.

• Primary Identifier: Expr948
• Remark: GFP expression matched the expression pattern of a daf-4::gfp gene fusion (Patterson et al., 1997), suggesting that daf-4 regulatory sequences conferring tissue-specificity are upstream of the transcription start site.
• Pattern: GFP was expressed in the pharynx, intestine, hypodermis and body wall muscles, in L1 through adult stages. In the head, GFP was seen in neurons of the lateral, vesicular and retrovesicular ganglia. Ventral cord neurons also were visible, as was the PVT neuron, but only two phasmid neurons were detected in the tail. Whereas the nervous system is the primary site of gfp expression mediated by the daf-1 promoter, the daf-4 promoter directs expression more broadly, consistent with its other functions. In L1 larvae, when the dauer/nondauer decision is made, daf-4 promoter is active in neurons in the head, as well as in the ventral cord and tail. The promoters continues to express GFP in dauer larvae from starved plates.

• Primary Identifier: Expr14056
• Remark: Other Strain: OH14247
• Pattern: ASI, sometimes a neuron pair in the ventral ganglion next to ASJ, pharynx (dim), posterior gut, PVT

• Primary Identifier: Expr14099
• Remark: Other Strain: OH13852
• Pattern: ASI, ASK (dim), 1 neuron pair in ventral ganglion, AIY, pharynx, pharyngeal-intestinal valve, PVT

• Primary Identifier: Expr14106
• Remark: Other strain: OH14976
• Pattern: ASI, pharynx, VNC neurons (dim), HSN, vulva muscle, posterior gut, 1 neuron pair in the ventral ganglion

• Primary Identifier: Expr14117
• Pattern: Several head sensory neurons (ASI, ASH, ASJ), one neuron pair in ventral ganglion, AVG, ALN, PLN, pharynx

• Primary Identifier: Expr14204
• Remark: Other Strain: OH14266
• Pattern: ASI, sometimes a pair of inter/motorneurons from the ventral ganglion, pharynx, gut, PVT

• Primary Identifier: Expr14233
• Remark: Other Strain: OH14286
• Pattern: ASI, one neuron pair in ventral ganglion, anterior pharynx, posterior gut, vulva muscle, PVT, some other cells in the anterior head

• Primary Identifier: Expr15
• Remark: life_stage summary : postembryonic
• Pattern: Expression is seen in 4 neural cells of the anterior ganglion, 8 more in the lateral/ventral ganglia, and 4-6 nuclei of the tail ganglia. Staining is also seen on sub-cellular particles in the vm1 muscles of the vulva. The neural pattern develops from L1 onwards; the vulval staining occurs L4 onwards.
• Subcellular Localization: Expressed in nuclei.

• Primary Identifier: Expr18
• Remark: life_stage summary : post L2 life_stage summary = post L1 or post L2
• Pattern: Earliest expression is seen from L1 stage. It is seen in three neurons in the head ganglia. Nuclei of the lateral/ventral ganglia show expression from L2/3 onwards. Further staining of 3 cells, possibly in the tail ganglia, develops in adult worms along with a few nuclei in the ventral cord. Cytoplasmic staining of the neural processes in the ventral nerve cord occurs as well. nuclei of the lateral/ventral ganglia show expression from L2/3 onwards. Further staining of 3 cells, possibly in the tail ganglia, develops in adult worms along with a few nuclei in the ventral cord.

• Primary Identifier: Expr50
• Remark: Fusion junction ...AGCTCTCCAACGATGTACGAGAGAAGGATGCTGGGAAGGTCGTGGAAGTGTTGAAAGTCACGACCACGG TCAATAGATTATGTAGAGGATTCCCTACGTCACGAGTATCTAGATGGATTGCAAGGGGAAGAGGACGCACTG GCAAAGATC/lacZ. Legacy Data: Author "Arnold JM" "Krupa AP" "Hope IA". Date 1992-01. Young and Hope (1993). Dev. Dynam. 196:124-132 = [cgc1752]
• Pattern: b-galactosidase expression in areas of all the major ganglia (lateral, ventral, retrovesicular, pre-anal and dorso-rectal), along the ventral nerve cord, occasionally in the spermathecal valves and in the vulva. Expression appears to be nuclear-localized, although cell bodies and neural processes in the ventral nerve cord also show staining. The pattern is first visualized as a stripe of staining following the curve of the elongating embryo, possibly corresponding to the embryonic ventral nerve cord which consists of the DA, DB and DD motorneurones

• Primary Identifier: Expr11003
• Pattern: tyra-3::gfp showed reliable expression in ASK, ADL, AIM, AUA, BAG, CEP, OLQ and SDQL neurons, in other unidentified neurons in the ventral ganglion and the tail, occasionally in AFD and AWC neurons, and in two non-neuronal cell types, the spermatheca and the distal tip cell.

• Primary Identifier: Expr3065
• Subcellular Localization: Anti-GPA-2 antibodies stained many cilia, cell bodies, and axons in the head. Two cell bodies in the anterior ganglion, two pharyngeal muscle cells, and seven cell bodies in the lateral and ventral ganglia showed staining, indicating that GPA-2 is expressed in more cells than initially identified. Importantly, in addition to rod-like cilia, the typical wing shape of the AWC cilia could be distinguished at high magnification. This confirms that GPA-2 is expressed in the AWC cells. No indications of GPA-2 expression in the AWA cells was found.

• Primary Identifier: Expr12869
• Pattern: qui-1::GFP was visible in the processes of the nerve ring and in several neurons of the lateral and ventral ganglia, including the avoidance sensory neurons ASH and ADL. GFP expression was not detected in ASK sensory neurons. Four additional neurons in the retrovesicular ganglion and two neurons in the lumbar ganglion, PVQ and the sensory neuron PHB, also express GFP. This expression pattern partially overlaps but is not completely coincident with that obtained with a much shorter construct in which GFP was fused to the second exon, and the construct was thus missing part of exon 2 and the last 17 introns and exons of the gene (not shown). Expression from this shorter construct included neither ASH nor PHB, indicating that important regulatory elements are present within the coding region of qui-1.
• Subcellular Localization: In the ASH sensory neurons, the reporter protein uniformly stained the cell body, nucleus, dendrite and axon. The staining was too faint to unambiguously determine whether QUI-1::GFP localized also in the cilia. In most of the other neurons, expression of GFP was lower in all cellular compartments and apparently absent from the nucleus.

• Primary Identifier: Expr2266
• Remark: Since these gfp fusions lack the introns and the 3' untranslated region, they might be lacking potential regulatory sequences. In that case, the gfp expression patterns may not precisely represent those of the endogenous kin-8 gene. cam-1 is called kin-8 in this article.
• Pattern: Expressed in chemosensory neurons in amphid: ADL, ASI, ASH, ASK. Sensory neuron: AUA. Interneurons: AIM, ADA, DVC, RIM, RIV, RMG, URX, AVE, PVT. About 10 neurons anterior to the nerve ring in the ring ganglion. About 2 neurons in the ventral ganglion. Four muscles in the head. The expression patterns did not appear to change through the larva to adult stages. Embryonic expression was also observed.

• Primary Identifier: Expr16049
• Pattern: nmgp-1 expresses mostly in sensory neurons and in the egg-laying apparatus of adult hermaphrodites. GFP expression driven by the putative nmgp-1 promoter was detected in several cells, primarily neurons. Within the head, we saw GFP expression in pharyngeal neurons, as many somas and processes within the metacorpus and the posterior bulb ventral ganglia were observed. In addition, some of the processes next to the bulb might correspond to CEP sheath glial cells. In the midbody, we saw labeling of cells within the egg-laying apparatus. Posteriorly, we observed cells in the tail ganglia and possibly phasmid neurons. Neuronal processes along dorsal and ventral cords were also labeled. In addition, to identify specific neurons, we used the NeuroPAL strain (OH15500) developed by Hobert's Lab (Yemini et al., 2021). This strain has a stereotyped fluorescent color map to identify all neurons. We injected it with the same plasmid for GFP expression under the nmgp-1 promoter. The following neurons were identified as expressing GFP: ALA, CEPD, IL1 (head neurons from the nerve ring), the sensory amphid neurons ASK, neurons from the anterior ventral nerve cord (VA6, VB7, DB5, AS5, VD6, DD3, DA4) and posterior ventral cord (VA11, VD11, AS10, DA7, DB7, CB11, VA11), neurons from the preanal ganglion (PVP, PVT, DD6, AS11, VA12, DA8, DA9) dorso-rectal ganglion (DVB, DVA, DVC) and lumbar ganglion (PVQ, PHC). The neurons identified include sensory neurons (amphid and mechanosensory), motor neurons and interneurons.

• Primary Identifier: Expr14009
• Pattern: ASK, RID, AIY, RIF, 1 pair in ventral ganglion

• Primary Identifier: Expr14047
• Pattern: ASK, ASI (dim), in few worms one neuron in the ventral ganglion, PVT

• Primary Identifier: Expr14112
• Pattern: ASI, 1 pair in ventral ganglion - a bit dim and variable

• Primary Identifier: Expr14144
• Pattern: ASI, sometimes an inter/motorneuron in the ventral ganglion - variable

• Primary Identifier: Expr14151
• Pattern: ADF, ASI (dim), URX, sometimes 1 inter/motorneurons in the ventral ganglion or RVG

• Primary Identifier: Expr14000
• Pattern: URX, AVB, RIF, AIY, 1 pair in ventral ganglion, 1 pharyngeal neuron, PVT (in Wormbase another sra-11 reporter is annotated as also being expressed in AIA and VC)

• Primary Identifier: Expr14087
• Remark: Other Strain: OH14338
• Pattern: ADL, other head neurons in anterior and ventral ganglion (much dimmer), PHA, PHB, vulva, anterior sheath/socket cells (Amsh/Amso?), males - expression in rays

• Primary Identifier: Expr1632
• Pattern: Although the antibody and reporter patterns coincide in a number of key aspects, a few differences are evident. Expression in the head hypodermal cells upon hatching is only faintly detected with the gfp reporter construct. Moreover, only a few neurons in the head express the ceh-32::gfp construct, compared with the immunostaining results. These differences could reflect that positive control elements are missing or inactive in the reporter transgenes. The expression of ceh-32 begins during the embryonic development, during the gastrulation stage (in 100-min-old embryos), and persists until adults. Embryonic expression of ceh-32 is detected in the anterior part of the embryos in head hypodermal and neuronal precursor cells. Upon hatching, ceh-32 is expressed in the hypodermal and neuronal cells of the head as well as in the somatic gonad. The head hypodermal nuclei expressing CEH-32 were identified as the nuclei of hyp3, hyp4, hyp5, and the first ventral nuclei of hyp6. In the head neurons, ceh-32 is found expressed in 12 cells of the anterior ganglion, in the sensory neurons ADL, in a pair of neurons in the dorsal side of lateral and ventral ganglion, and in 8 neurons in the ventral side of the lateral and ventral ganglion. Some weakly expressing cells were not identified. In the somatic gonad, the expression of ceh-32 begins at the L1/L2 stage in the sheath/spermatheca (SS) precursor cells, and this expression is maintained during the development of the somatic gonad in the gonadal sheath cells. In the adult worm, all the gonadal sheath cells express ceh-32.
• Subcellular Localization: The CEH-32 protein is detected exclusively in the nuclei.

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
ganglion in the head.	head ganglion		WBbt:0005135