WormMine: Gene WBGene00000403

• WormBase Gene ID: WBGene00000403
• Gene Name: casy-1
• Sequence Name: B0034.3
• Brief Description: casy-1 encodes a type I transmembrane protein with two extracellular cadherin domains and an LG/LNS domain that is the sole C. elegans calsyntenin/alcadein ortholog; genetic studies indicate that in C. elegans casy-1 activity is required, in parallel to the insulin-like signaling pathway, for several types of learning, including salt chemotaxis learning, temperature learning, olfactory adaptation, and integration of two sensory stimuli; large-scale RNAi experiments also suggest that casy-1 plays a role in embryonic development; casy-1 expression in adult animals is able to rescue salt chemotaxis learning defects, indicating that CASY-1 function in mature animals is sufficient to effect proper chemotactic behavior; in addition, CASY-1 expression in the ASER neuron, but not other neurons, rescues salt chemotaxis learning defects, indicating the CASY-1 can act solely in this chemosensory neuron for normal salt chemotaxis learning; a casy-1::GFP promoter fusion is expressed throughout the nervous system, including the head amphid sensory neurons, with additional expression seen in the intestine and gonadal sheath cells; a CASY-1::GFP protein fusion localizes to the plasma membrane and intracellular membranes of neuronal cell bodies, with specific N-terminal fusions indicative of CASY-1 ectodomain release into the extracellular space; domain-specific rescue experiments indicate that the secreted, proteolytically processed CASY-1 extracellular domain is sufficient to rescue salt chemotaxis learning defects.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable calcium ion binding activity. Involved in several processes, including GABAergic synaptic transmission; olfactory learning; and positive regulation of synaptic vesicle transport. Located in several cellular components, including extracellular region; neuromuscular junction; and neuronal cell body membrane. Expressed in neurons. Is an ortholog of human CLSTN2 (calsyntenin 2) and CLSTN3 (calsyntenin 3).
• Biotype: SO:0001217
• Genetic Position: II :-0.800583 ±0.01344
• Length (nt): 11279

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000403

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0034.3b.1	B0034.3b.1	1134	II: 5945405-5948811
Transcript:B0034.3a.1	B0034.3a.1	3442	II: 5945407-5956683
Transcript:B0034.3c.1	B0034.3c.1	483	II: 5945855-5947303
Transcript:B0034.3d.1	B0034.3d.1	543	II: 5945855-5947516

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0034.3d	B0034.3d	543	II: 5945855-5946014
CDS:B0034.3a	B0034.3a	2955	II: 5945855-5946014
CDS:B0034.3b	B0034.3b	504	II: 5945855-5946014
CDS:B0034.3c	B0034.3c	483	II: 5945855-5946014

4 RNAi Result

• WBRNAi00038664
• WBRNAi00038665
• WBRNAi00009558
• WBRNAi00027950

160 Allele

• gk963801
• gk963053
• gk964349
• WBVar00240189
• WBVar01603957
• WBVar01603956
• tm718
• WBVar01438027
• WBVar01438025
• WBVar01438026
• WBVar01373577
• WBVar01373588
• WBVar01719975
• WBVar01719974
• h17906
• h15112
• WBVar00224004
• gk143952
• gk143951
• gk143954
• gk143953
• gk143948
• gk143950
• gk143949
• gk143960
• gk143959
• gk143962
• gk143961
• gk143956
• WBVar01982478

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000403
• Start: 5945405
• End: 5956683
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_5944369..5945404
• Length (nt): 1036
• Chromosome Location: II: 5944369-5945404
• Organism: Caenorhabditis elegans

242 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_larva_enriched
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed

17 Expression Patterns

• Primary Identifier: Expr5014
• Remark: Strain: BC10331
• Reporter Gene: [cdh-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTTCAAATCAACTGCCAATTC] 3' and primer B 5' [GAGTAAGAGAGCCTGGTTGGAA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5015
• Remark: Also expressed in (comments from author) : No comment. Strain: BC11525
• Reporter Gene: [cdh-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTTCAAATCAACTGCCAATTC] 3' and primer B 5' [GAGTAAGAGAGCCTGGTTGGAA] 3'.
• Pattern: Adult Expression: intestine; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: intestine; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr2009725
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1030221
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr8074
• Remark: Picture: Figure 3B, 3C.
• Pattern: Fluorescent signals were observed throughout the nervous system and in other tissues such as intestine and gonadal sheath cells. Strong GFP signals were found in many head neurons, including most amphid sensory neurons. The expression was observed from the embryonic stage.

• Primary Identifier: Expr8578
• Remark: A GFP-tagged CASY-1 protein was reported to localize at synapses (Duan and Hedgecock, personal communication). Picture: Fig. 2A.
• Pattern: A transcriptional casy-1 reporter is expressed in many head nerve ring neurons, some of which send processes into the ventral nerve cord. Expression of casy-1p::RFP is also detected in RMDDL, SMDDL, and SMDVL neurons.

• Primary Identifier: Expr8075
• Remark: Picture: Fig. S4.
• Subcellular Localization: CASY-1 is mainly localized to cell bodies of neurons, especially plasma membranes and intracellular membranes. Localization of the protein in the neuronal processes was not evident but occasionally observed.

• Primary Identifier: Expr13726
• Pattern: As reported earlier, strong expression of casy-1a was observed in a lot of head neurons including the amphid sensory neurons, the Ventral Nerve Cord (VNC) and some tail neurons. Expression was also observed in somatic tissues like gonadal sheath and intestine. The weak expression of casy-1a in the VNC belongs to the axonal processes from the head neurons that traverse along the entire length of the C. elegans body. casy-1a transcriptional reporter does not co-localize with mCherry marked cholinergic or GABAergic motor neurons.

• Primary Identifier: Expr13727
• Pattern: casy-1b and casy-1c showed co-localization with both cholinergic and GABAergic neuronal markers. casy-1b and casy-1c show a more limited expression than casy-1a in the head neurons. However, both casy-1b and casy-1c are strongly expressed in the VNC motor neurons, which is not seen with casy-1a. No expression was observed in the gonadal sheath for the shorter isoforms.

• Primary Identifier: Expr11985

• Primary Identifier: Expr2027964
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr13728
• Subcellular Localization: The CASY-1C::mCherry protein localizes all along the dorsal cord axons and shows co-localization with the GABAergic and cholinergic pre-synaptic SNB-1::GFP markers.

• Primary Identifier: Chronogram1435
• Remark: Original chronogram file: chronogram.313.xml
• Reporter Gene: [B0034.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1196
• Remark: Original chronogram file: chronogram.2317.xml
• Reporter Gene: [B0034.3:gfp] transcriptional fusion.

• Primary Identifier: Expr1142870
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr11885
• Subcellular Localization: When CASY-1 was fused with Venus and expressed in ASER, it was mainly localized to the cell body and weakly present in the axon in both fed and starved animals. In the cell body, CASY-1 was partially co-localized with a Golgi marker protein AMAN-2. The amount of the observable CASY-1 in the axon was too small to determine its exact role along the axon.

• Primary Identifier: Expr1027829
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

31 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000403
• Start: 5945405
• End: 5956683
• Strand: -1

31 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 11279

1 Sequence Ontology Term

• Name: gene

7 Strains

• WBStrain00022694
• WBStrain00031601
• WBStrain00055675
• WBStrain00055673
• WBStrain00055105
• WBStrain00001795
• WBStrain00001794

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_5956684..5957679
• Length (nt): 996
• Chromosome Location: II: 5956684-5957679
• Organism: Caenorhabditis elegans