WormMine: Gene WBGene00001130

• WormBase Gene ID: WBGene00001130
• Gene Name: dyn-1
• Sequence Name: C02C6.1
• Brief Description: dyn-1 encodes the C. elegans ortholog of the dynamin GTPase; dyn-1 activity is required for endocytosis, synaptic vesicle recycling, cytokinesis, and the CED-1 pathway that regulates engulfment and degradation of apoptotic cells; mutations in dyn-1 affect locomotion, egg-laying, defecation, and embryonic development, indicating that dyn-1's endocytic function is required for a number of diverse processes; dyn-1 reporter fusion constructs are expressed in motor neurons, intestinal cells, and pharyngeal muscle.
• Organism: Caenorhabditis elegans
• Automated Description: Enables GTPase activity. Involved in several processes, including embryo development; endocytosis; and necroptotic process. Located in several cellular components, including plasma membrane; plasma membrane bounded cell projection; and spindle microtubule. Expressed in several structures, including neurons; non-striated muscle; pharyngeal-intestinal valve; rectal valve cell; and somatic nervous system. Used to study early infantile epileptic encephalopathy. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; Charcot-Marie-Tooth disease dominant intermediate B; centronuclear myopathy 1; and developmental and epileptic encephalopathy (multiple). Is an ortholog of human DNM1 (dynamin 1); DNM2 (dynamin 2); and DNM3 (dynamin 3).
• Biotype: SO:0001217
• Genetic Position: X :22.8512 ±0.008189
• Length (nt): 4101

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001130

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C02C6.1b.1	C02C6.1b.1	2517	X: 15568921-15572949
Transcript:C02C6.1a.1	C02C6.1a.1	2671	X: 15568921-15573021

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C02C6.1b	C02C6.1b	2517	X: 15568921-15569087
CDS:C02C6.1a	C02C6.1a	2493	X: 15568921-15569087

52 RNAi Result

• WBRNAi00098329
• WBRNAi00093453
• WBRNAi00024449
• WBRNAi00008324
• WBRNAi00109173
• WBRNAi00080545
• WBRNAi00116124
• WBRNAi00066834
• WBRNAi00085562
• WBRNAi00039407
• WBRNAi00071879
• WBRNAi00080730
• WBRNAi00080732
• WBRNAi00080735
• WBRNAi00080734
• WBRNAi00080736
• WBRNAi00097855
• WBRNAi00098528
• WBRNAi00098555
• WBRNAi00098562
• WBRNAi00080729
• WBRNAi00080731
• WBRNAi00080733
• WBRNAi00065879
• WBRNAi00109562
• WBRNAi00065881
• WBRNAi00087688
• WBRNAi00064262
• WBRNAi00071641
• WBRNAi00028338

92 Allele

• gk964260
• gk962707
• gk963810
• gk963581
• WBVar01929052
• WBVar01929053
• gk963583
• tm852
• gk303706
• gk303711
• gk303712
• gk303709
• gk303710
• gk303707
• gk303708
• gk303713
• gk303714
• WBVar01545177
• WBVar01545178
• jh133
• jh134
• WBVar02027807
• WBVar01942418
• WBVar01942417
• gk952542
• WBVar01942416
• n4039
• WBVar00221985
• WBVar00221983

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001130
• Start: 15568921
• End: 15573021
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_15573022..15575525
• Length (nt): 2504
• Chromosome Location: X: 15573022-15575525
• Organism: Caenorhabditis elegans

155 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage.	DEseq2, fold change > 2	WBPaper00064505:tamoxifen_upregulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
	Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines.	RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1.	WBPaper00035269:cde-1_regulated
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated

16 Expression Patterns

• Primary Identifier: Expr5106
• Remark: Strain: BC13292
• Reporter Gene: [dyn-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTCAAAATATCCGGTCAAAGT] 3' and primer B 5' [GATGGCTGATCCTGGTGG] 3'.
• Pattern: Adult Expression: pharynx; intestine - posterior cells; body wall muscle; seam cells; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine - posterior cells; seam cells; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr1030720
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr3952
• Remark: Site of action: To determine whether DYN-1 activity is required in the engulfing cell or the dying cell for the removal of cell corpses, dyn-1 cDNA was expressed under the control of the engulfing cell-specific promoter Pced-1 or the dying cell-specific promoter Pegl-1 and authors examined the ability of these transgenes to promote engulfment. Pced-1 dyn-1::gfp rescued the Ced phenotype of dyn-1(n4039) to the same extent as Pdyn-1 dyn-1cDNA. In contrast, Pegl-1 dyn-1::gfp did not exhibit significant rescuing activity, although it produced a GFP signal in dying cells. These results indicate that the dyn-1 activity in engulfing cells, but not in dying cells, is sufficient for the rescue of the Ced phenotype. dyn-1 thus primarily functions in engulfing cells for the removal of apoptotic cells.
• Pattern: In larvae and adult hermaphrodites, the expression of a Pdyn-1 dyn-1::gfp reporter was observed in all previously described dyn-1-expressing tissues, including gonadal sheath cells. In embryos, many cell types express Pdyn-1 dyn-1::gfp, including known engulfing cells such as the hypodermal cells, intestinal precursor cells, and the entire pharyngeal primordium.

• Primary Identifier: Expr511
• Remark: Construct contained 2375 bp upstream of the dyn-1 ATG and 214 amino acids of DYN-1. Transgenic Marker: rol-6(su1006). Construct rescued dyn-1(ky51) uncoordinated and low-fertility phenotypes.
• Pattern: Expressed in motor neurons in head and ventral nerve cord; sensory neurons and sensory interneurons around nerve ring and tail; pharyngeal-intestinal valve, intestinal-rectal valve, and intestine; in m3 and m4. Expressed in all stages embryo through adult.

• Primary Identifier: Expr12550

• Primary Identifier: Expr512
• Remark: GFP construct did not rescue dyn-1(ky51) phenotype.
• Pattern: Expressed in nerve ring, ventral nerve cord, dorsal nerve cord, pharyngeal neurons, spermathecae, coelomocytes and apical surface of intestinal cells in adults.
• Subcellular Localization: In ALM neurons, localized at synapses; punctate distributions along ventral nerve cord. In intestine, localized along apical surface facing lumen.

• Primary Identifier: Expr8649
• Remark: Picture: Fig 1, Fig S3.
• Subcellular Localization: An enrichment of endogenous DYN-1 at the anterior cortex of one-celled embryos. in addition to the cleavage furrow and midbody accumulation reported previously. The mid-focal plane images showed that DYN-1bFL-GFP localized to the anterior cortex and newly formed furrow membrane, as observed for the endogenous DYN-1. DYN-1bFL-GFP was distributed throughout the entire cortex as small punctate foci prior to polarity establishment, moving anteriorly during cortical flows. By pseudocleavage, DYN-1bFL-GFP foci were confined to the anterior half. This anterior localization was maintained throughout mitosis, similar to the localization of GFP-PAR-6.

• Primary Identifier: Expr11970
• Reporter Gene: Two-color splicing reporter.
• Pattern: Monitoring alternative exon 8 in the GTPase dyn-1/Dynamin revealed that the exon-included isoform is preferentially expressed in lateral ganglion neurons posterior to the nerve ring, while the exon-excluded isoform predominates in more anteriorly positioned pharyngeal neurons.

• Primary Identifier: Expr2011142
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram741
• Remark: Original chronogram file: chronogram.1778.xml
• Reporter Gene: [C02C6.1:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1703
• Remark: Original chronogram file: chronogram.623.xml
• Reporter Gene: [C02C6.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1014421
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr10743
• Subcellular Localization: DYN-1 dynamin punctate GFP localization was observed in the far distal dendrite region, immediately proximal to cilia. The distal extent of these endocytic protein pools overlapped with the CHE-13 pool at the ciliary base. These intraflagellar transport (IFT) pools correspond to the transitional fiber region below ciliary transition zones and thus precisely mark the junction between dendritic and ciliary compartments. Signals were also found in other parts of the cell including at presynaptic zones.

• Primary Identifier: Expr2307
• Remark: Treatment of C. elegans embryos and gonads with dyn-1 RNAi resulted in a depletion of dynamin staining, as observed by immunofluorescence staining, indicating that the dynamin gene was targeted by using RNAi and that dynamin protein expression was reduced. In addition, this observation supports the specificity of the dynamin antibody used in this study.
• Subcellular Localization: By immunostaining early embryos with an antibody specific for the C. elegans dynamin homolog, the C. elegans homolog to conventional dynamin was shown localized to mitotic spindles. During metaphase/early anaphase, dynamin was markedly concentrated around the metaphase plate and was also present on several large cytoplasmic vesicles. Later in anaphase, dynamin became concentrated equatorially and also localized along spindle microtubules in a manner similar to the localization of dynamin along spindle microtubules in mammalian cells. Further, in C. elegans embryos, dynamin localized to the newly formed cleavage furrow and accumulated at the midbody as the embryos progressed through the early and late stages of cytokinesis.

• Primary Identifier: Expr2029378
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1143523
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

53 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001130
• Start: 15568921
• End: 15573021
• Strand: 1

53 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4101

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00063252
• WBStrain00005217
• WBStrain00002824
• WBStrain00002541
• WBStrain00005363

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_15564580..15568920
• Length (nt): 4341
• Chromosome Location: X: 15564580-15568920
• Organism: Caenorhabditis elegans