WormMine: Gene WBGene00001263

• WormBase Gene ID: WBGene00001263
• Gene Name: emb-9
• Sequence Name: K04H4.1
• Brief Description: emb-9 encodes the alpha-1 chain of Type IV basement membrane collagen most closely equivalent to human COL4A1 (OMIM:120130) on the basis of biological function; EMB-9 forms heterotrimeric Type IV collagen with LET-2, the alpha-2-like chain, and is required for the assembly and/or secretion of LET-2; EMB-9 is essential for embryonic morphogenesis, particularly epidermal elongation, and for larval development; EMB-9 is expresed primarily by body wall muscles and some somatic cells of the gonad and is detected in nearly all basement membranes.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be an extracellular matrix structural constituent conferring tensile strength. Involved in several processes, including positive regulation of axon regeneration; positive regulation of protein secretion; and response to serotonin. Located in basement membrane. Expressed in several structures, including coelomocyte; egg-laying apparatus; gonad; nerve ring; and rectal muscle. Human ortholog(s) of this gene implicated in several diseases, including X-linked Alport syndrome; X-linked deafness 6; and artery disease (multiple). Is an ortholog of human COL4A1 (collagen type IV alpha 1 chain).
• Biotype: SO:0001217
• Genetic Position: III :0.421546 ±0.00256
• Length (nt): 7567

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001263

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K04H4.1a.1	K04H4.1a.1	5611	III: 9336881-9344447
Transcript:K04H4.1b.1	K04H4.1b.1	4509	III: 9337163-9344398

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K04H4.1a	K04H4.1a	5280	III: 9337163-9337258
CDS:K04H4.1b	K04H4.1b	4509	III: 9337163-9337258

29 RNAi Result

• WBRNAi00114290
• WBRNAi00114055
• WBRNAi00114134
• WBRNAi00114213
• WBRNAi00094364
• WBRNAi00049958
• WBRNAi00025875
• WBRNAi00094166
• WBRNAi00008958
• WBRNAi00061449
• WBRNAi00061451
• WBRNAi00061452
• WBRNAi00061453
• WBRNAi00061454
• WBRNAi00071905
• WBRNAi00113856
• WBRNAi00061450
• WBRNAi00071345
• WBRNAi00024284
• WBRNAi00114015
• WBRNAi00114094
• WBRNAi00114173
• WBRNAi00002566
• WBRNAi00078095
• WBRNAi00087215
• WBRNAi00070187
• WBRNAi00085494
• WBRNAi00094480
• WBRNAi00113855

136 Allele

• gk964518
• gk963887
• WBVar00070733
• WBVar00070718
• WBVar00070728
• gk410256
• gk690376
• gk713182
• gk532792
• gk877567
• gk507365
• gk404733
• gk673908
• gk814022
• gk332109
• gk335937
• gk797582
• gk326746
• gk632205
• gk838151
• gk372452
• gk475629
• gk355281
• gk424416
• gk899924
• gk502105
• gk327492
• gk484355
• gk525842
• gk927597

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001263
• Start: 9336881
• End: 9344447
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_9335244..9336880
• Length (nt): 1637
• Chromosome Location: III: 9335244-9336880
• Organism: Caenorhabditis elegans

235 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite N2 animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
mitochondrial sulfide delivery molecule (mtH2S) AP39	Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after 24 hours of induction of human beta Amyloid at young adult stage	A 2-fold change in expression level and a false discovery rate analog of p < 0.05.	WBPaper00064130:Beta-Amyloid_24h_upregulated_mRNA
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated

14 Expression Patterns

• Primary Identifier: Expr1030798
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6327
• Remark: Strain: BC10074
• Reporter Gene: [emb-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAACCAGTTGTATGATTGTTC] 3' and primer B 5' [GCGTGAGATCTTCCAGTCAC] 3'.
• Pattern: Adult Expression: anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; unidentified cells in tail ; Larval Expression: anal depressor muscle; body wall muscle; unidentified cells in tail

• Primary Identifier: Expr14283
• Pattern: EMB-9::mcherry strongly localized to BM in pharynx. We also confirmed strong expression of EMB-9::mcherry in coelomocytes, but not in the strain expressing mkate2::NID-1. The mkate2::NID-1 and EMB-9::mcherry are similarly localized to BM at gonad and uterus.

• Primary Identifier: Expr518
• Remark: Reporter construct derived from clones that rescue emb-9 phenotype. Transgenic Marker: rol-6(su1006). late embryo(author) = fully-elongated embryo(curator).
• Pattern: Body wall muscle cells, hmc and MS.pppaaa show expression in early embryo. In later embryo through adulthood, stain accumulates between the hypodermis and four body muscle quadrants, and surrounds the pharynx, intestine and primordial gonad at L1 through adulthood. Presumptive GLRDL, GLRDR, GLRL, GLRR, GLRVL, GLRVR, coelomocytes, and anal muscles show expression in addition to body muscle cells at L1, L2, L3 L4 and adult. Distal tip cells of developing gonad in L2, L3, and L4. Spermathecal cells and distal ends of gonad show expression at L4 and adult. Vulval and uterine muscles in adult. Also expressed in two to four posterior intestinal cells.
• Subcellular Localization: Preceding lima stage, intracellular. Later, extracellular around muscle quadrant-hypodermis interface, pharynx, intestine and gonad. Gonad and muscle stain intracellularly, pharynx and hypodermis do not. Four antibodies to type IV collagen gave same expression pattern.

• Primary Identifier: Expr15039
• Pattern: Both MIG-17 and EMB-9 localize in the head-region to a pattern reminiscent of the extracellular matrix proximal to the pharynx bulb. EMB-9 protein levels increased as animals progress through the larval stages, achieving maximal expression in the adult stage.

• Primary Identifier: Expr14507
• Pattern: Type IV collagen localizes to the BM and is expressed primarily in the body wall muscles, with the neuronal ring ganglion, spermatheca, uterine mucles, vulval muscles, and the distal tip cell of the somatic gonad also contributing collagen during specific larval stages.

• Primary Identifier: Expr14702
• Pattern: Consistent with previous studies, the type-IV collagen α1 chain construct, EMB-9::mCherry, when expressed from the integrated transgene tkTi1[emb-9::mCherry], localized to the gonadal basement membrane in WT C. elegans.

• Primary Identifier: Expr2011304
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1153653
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2029540
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr14508
• Subcellular Localization: SPARC and collagen colocalize in intracellular vesicles in C. elegans. Much of the intracellular colocalization is likely rough ER, as SPARC::GFP colocalized with the ER marker TRAM::mCherry.

• Primary Identifier: Chronogram1090
• Remark: Original chronogram file: chronogram.2154.xml
• Reporter Gene: [K04H4.1:gfp] transcriptional fusion.

• Primary Identifier: Expr14680
• Subcellular Localization: mCherry (emb-9p:: emb-9::mCherry) localizes to the basement membrane.

• Primary Identifier: Expr1024531
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

19 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001263
• Start: 9336881
• End: 9344447
• Strand: -1

19 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 7567

1 Sequence Ontology Term

• Name: gene

17 Strains

• WBStrain00026558
• WBStrain00033520
• WBStrain00049759
• WBStrain00049676
• WBStrain00050771
• WBStrain00050796
• WBStrain00054902
• WBStrain00054931
• WBStrain00054890
• WBStrain00005034
• WBStrain00005484
• WBStrain00005035
• WBStrain00001153
• WBStrain00007826
• WBStrain00007832
• WBStrain00005808
• WBStrain00005811

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_9344448..9344812
• Length (nt): 365
• Chromosome Location: III: 9344448-9344812
• Organism: Caenorhabditis elegans