WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; unidentified cells in tail ; Larval Expression: anal depressor muscle; body wall muscle; unidentified cells in tail ; Primary Identifier  Expr6327
Remark  Strain: BC10074 Reporter Gene  [emb-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAACCAGTTGTATGATTGTTC] 3' and primer B 5' [GCGTGAGATCTTCCAGTCAC] 3'.

6 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
posterior region, from rectum to the end tail   WBbt:0005741
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001263 emb-9 K04H4.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023