WormMine: Gene WBGene00001637

• WormBase Gene ID: WBGene00001637
• Gene Name: gly-12
• Sequence Name: F48E3.1
• Brief Description: gly-12 encodes an experimentally verified UDP-N-acetylglucosamine alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I (GnT I), expressed throughout development in many cell types; a deletion allele of gly-12 is phenotypically normal even as a double or triple mutant with gly-13 and gly-14.
• Organism: Caenorhabditis elegans
• Automated Description: Enables alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity. Involved in protein N-linked glycosylation. Located in perinuclear region of cytoplasm. Expressed in body wall musculature; ganglia; hypodermis; and intestine. Is an ortholog of human MGAT1 (alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase).
• Biotype: SO:0001217
• Genetic Position: X :-1.66589 ±0.002603
• Length (nt): 4844

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001637

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F48E3.1.1	F48E3.1.1	2179	X: 7485864-7490707
Transcript:F48E3.1.2	F48E3.1.2	1787	X: 7486004-7489876
Transcript:F48E3.1.3	F48E3.1.3	1870	X: 7486155-7490695

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F48E3.1	F48E3.1	1404	X: 7486172-7486294

3 RNAi Result

• WBRNAi00047740
• WBRNAi00032483
• WBRNAi00000768

85 Allele

• gk964260
• gk963873
• gk963874
• gk964088
• gk964087
• gk964005
• gk964003
• gk571710
• gk536583
• gk622718
• WBVar01758766
• WBVar01758765
• WBVar01758768
• WBVar01758767
• WBVar02064768
• WBVar02064769
• WBVar01820274
• WBVar02027216
• WBVar01883514
• WBVar01883515
• WBVar01883516
• ok1026
• WBVar00080533
• WBVar00080534
• gk524898
• gk718656
• id47
• gk767828
• gk436943
• gk370191

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001637
• Start: 7485864
• End: 7490707
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

168 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
starvation 12 hours	Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals.	EdgeR, FDR < 0.05, fold change >= 2.	WBPaper00067259:starvation_upregulated_intestine
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
	Transcripts that showed significantly decreased expression in N2 day 4 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day4_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 5 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day5_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day7_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster3
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed

11 Expression Patterns

• Primary Identifier: Expr1030983
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6110
• Remark: Strain: BC13884
• Reporter Gene: [gly-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTATCTATCAGGAGAAGGAACGA] 3' and primer B 5' [TGGTGGTCCTTGGAAAGAAG] 3'.
• Pattern: Adult Expression: seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr1151574
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr649
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: beta-gal expression was seen throughout all developmental stages and in many tissues: intestine, muscle (probably body wall muscle), hypodermis, other epithelial cells, head and tail ganglia.

• Primary Identifier: Chronogram1596
• Remark: Original chronogram file: chronogram.478.xml
• Reporter Gene: [F48E3.1:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1597
• Remark: Original chronogram file: chronogram.479.xml
• Reporter Gene: [F48E3.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2030370
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr650
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Major band at ~2.1 kb. Higher level at embryo stage (embryo fraction contains mixture of embryo stages) other than that no significant variation between different life stages.

• Primary Identifier: Expr651
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Higher level of message at embryo stage. Expressed at all developmental stages with no major variation.

• Primary Identifier: Expr1012800
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2012134
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

21 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001637
• Start: 7485864
• End: 7490707
• Strand: 1

21 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4844

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00031774
• WBStrain00002771
• WBStrain00002770
• WBStrain00000248

0 Upstream Intergenic Region