WormMine: Gene WBGene00001945

• WormBase Gene ID: WBGene00001945
• Gene Name: his-71
• Sequence Name: F45E1.6
• Brief Description: his-71 encodes an H3 histone required for embryonic viability, body morphology, and larval viability.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be a structural constituent of chromatin. Predicted to be located in nucleus. Predicted to be part of nucleosome. Expressed in several structures, including somatic cell. Is an ortholog of human H3-3A (H3.3 histone A) and H3-3B (H3.3 histone B).
• Biotype: SO:0001217
• Genetic Position: X :-0.766026 ±0.018254
• Length (nt): 689

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001945

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F45E1.6.1	F45E1.6.1	591	X: 7981382-7982070

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F45E1.6	F45E1.6	411	X: 7981546-7981730

21 RNAi Result

• WBRNAi00070340
• WBRNAi00008802
• WBRNAi00047389
• WBRNAi00068405
• WBRNAi00068401
• WBRNAi00068402
• WBRNAi00068403
• WBRNAi00068404
• WBRNAi00068873
• WBRNAi00064716
• WBRNAi00007418
• WBRNAi00025508
• WBRNAi00114654
• WBRNAi00064086
• WBRNAi00064580
• WBRNAi00032297
• WBRNAi00096923
• WBRNAi00070338
• WBRNAi00070337
• WBRNAi00070339
• WBRNAi00096983

20 Allele

• gk964260
• gk962707
• gk964193
• gk964194
• gk963896
• gk963732
• gk964088
• gk964087
• WBVar01820379
• bon2
• gk723961
• ok2289
• gk762975
• gk507146
• gk569658
• tm2835
• gk779855
• gk660223
• gk849704
• WBVar02056485

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001945
• Start: 7981382
• End: 7982070
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_7980736..7981381
• Length (nt): 646
• Chromosome Location: X: 7980736-7981381
• Organism: Caenorhabditis elegans

202 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly decreased expression in morc-1(tm6048) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_morc-1(tm6048)_downregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
Pheromone	Pheromone-induced transcripts that showed significantly decreased expression in post dauer animals comparing to wild type control.	edgeR	WBPaper00053713:Pheromone-induced_postdauer_vs_control_downregulated
Starvation	Starvation-induced transcripts that showed significantly increased expression in post dauer animals comparing to wild type control.	edgeR	WBPaper00053713:Starvation-induced_postdauer_vs_control_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection.	DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1.	WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-1[KKRR]-smo-1 in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4748)_upregulated

9 Expression Patterns

• Primary Identifier: Expr4296
• Pattern: Broadly expressed.

• Primary Identifier: Expr4220
• Pattern: HIS-71::GFP displayed high levels of expression in almost all adult nuclei. With the his-71::GFP transgene, fluorescence was detected at the approximately 51-cell stage (embryos with four E blastomeres).
• Subcellular Localization: Expressed in nuclei.

• Primary Identifier: Expr6076
• Remark: Also expressed in (comments from author) : GFP::functional protein fusion. Strain: BC12400
• Reporter Gene: [his-71::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCATTCACCAAATAAGCTG] 3' and primer B 5' [TGCACGTTCTCCACGGATG] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; Nervous System; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr1151237
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2030720
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2012481
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr15136
• Pattern: His- 71 is expressed only in somatic cells and is undetectable in the germ line. His-71 expression is also absent in early embryonic development and only becomes detectable after gastrulation. At postembryonic stages, somatic expression of his-71 resembles that of his-72, but showes slightly lower nuclear GFP levels compared to his- 72.

• Primary Identifier: Expr1015060
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1200188
• Pattern: Data from the TransgeneOme project

11 GO Annotation

13 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001945
• Start: 7981382
• End: 7982070
• Strand: -1

11 Ontology Annotations

4 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in H3.3 null mutant animals (FAS43 [his-69&his-70(uge44) III; his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X]) comparing to in N2 animals at embryo stage.	Differentially expressed genes were estimated using a General Linear Model approach, negative binomial distribution, and a quasi-likelihood F-test. Genes with a P-value < 0.05 and fold change > 1 were considered significant.	WBPaper00054191:H3.3(null)_embryo_upregulated
	Transcripts that showed significantly increased expression in H3.3 null mutant animals (FAS43 [his-69&his-70(uge44) III; his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X]) comparing to in N2 animals at L1 larva stage.	Differentially expressed genes were estimated using a General Linear Model approach, negative binomial distribution, and a quasi-likelihood F-test. Genes with a P-value < 0.05 and fold change > 1 were considered significant.	WBPaper00054191:H3.3(null)_L1_upregulated
	Transcripts that showed significantly decreased expression in H3.3 null mutant animals (FAS43 [his-69&his-70(uge44) III; his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X]) comparing to in N2 animals at L1 larva stage.	Differentially expressed genes were estimated using a General Linear Model approach, negative binomial distribution, and a quasi-likelihood F-test. Genes with a P-value < 0.05 and fold change > 1 were considered significant.	WBPaper00054191:H3.3(null)_L1_downregulated
	Transcripts that showed significantly decreased expression in H3.3 null mutant animals (FAS43 [his-69&his-70(uge44) III; his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X]) comparing to in N2 animals at embryo stage.	Differentially expressed genes were estimated using a General Linear Model approach, negative binomial distribution, and a quasi-likelihood F-test. Genes with a P-value < 0.05 and fold change > 1 were considered significant.	WBPaper00054191:H3.3(null)_embryo_downregulated

1 Sequence

• Length: 689

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00032472
• WBStrain00034735
• WBStrain00007461
• WBStrain00007466

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_7982071..7985978
• Length (nt): 3908
• Chromosome Location: X: 7982071-7985978
• Organism: Caenorhabditis elegans