WormMine: Gene WBGene00002182

• WormBase Gene ID: WBGene00002182
• Gene Name: kap-1
• Sequence Name: F08F8.3
• Brief Description: kap-1 encodes a kinesin-associated protein that, along with KLP-20 and KLP-11, is part of the C. elegans heterotrimeric kinesin-II motor protein; animals homozygous for a kap-1 loss-of-function mutation have normal cilia and thus display normal dye-filling and osmotic avoidance behavior; however, animals doubly mutant for kap-1 and osm-3, which encodes a homomeric kinesin-II motor protein, do show defects in intraflagellar transport (IFT) indicating that the heteromeric kinsesin-II and homomeric OSM-3 motor protein complexes function redundantly to effect IFT; antibodies to KAP-1 detect high intensity staining in sensory neuron cilia; kap-1 expression in the AWB sensory neurons is positively regulated by FKH-2.
• Organism: Caenorhabditis elegans
• Automated Description: Contributes to microtubule motor activity. Involved in intraciliary anterograde transport; negative regulation of non-motile cilium assembly; and positive regulation of non-motile cilium assembly. Located in ciliary transition zone and non-motile cilium. Part of axonemal heterotrimeric kinesin-II complex. Expressed in ciliated neurons. Is an ortholog of human KIFAP3 (kinesin associated protein 3).
• Biotype: SO:0001217
• Genetic Position: III :-0.74971 ±0.000513
• Length (nt): 4833

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002182

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F08F8.3a.1	F08F8.3a.1	2335	III: 7338835-7343667
Transcript:F08F8.3a.2	F08F8.3a.2	2234	III: 7338994-7343667
Transcript:F08F8.3b.1	F08F8.3b.1	2142	III: 7339001-7343573

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F08F8.3a	F08F8.3a	2133	III: 7339001-7339070
CDS:F08F8.3b	F08F8.3b	2142	III: 7339001-7339070

3 RNAi Result

• WBRNAi00044028
• WBRNAi00012913
• WBRNAi00005204

67 Allele

• gk964518
• gk963887
• WBVar02067607
• WBVar01265378
• WBVar01265380
• WBVar01657034
• gk452888
• gk872491
• gk543125
• gk866002
• gk467591
• gk683931
• gk866000
• gk866001
• WBVar01990166
• gk359653
• gk790731
• gk329068
• gk937309
• gk931545
• gk376110
• gk585130
• gk498933
• gk788983
• gk574985
• gk462775
• WBVar02108936
• gk866003
• gk382050
• gk413342

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002182
• Start: 7338835
• End: 7343667
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_7343668..7343688
• Length (nt): 21
• Chromosome Location: III: 7343668-7343688
• Organism: Caenorhabditis elegans

116 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in skn-1(lax188) gain of function comparing to in N2 at day 2 adult stage.	fold change > 2	WBPaper00058711:skn-1(lax188)_downregulated
	Transcripts that showed significantly increased expression in wdr-5(ok1417);skn-1(lax188) comparing to in skn-1(lax188) at day 2 adult stage.	fold change > 2	WBPaper00058711:wdr-5(ok1417)_upregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:isp-1(qm150)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly altered expression in rnp-6(dh1127) animals comparing to in N2 when fed with heat killed E. coli OP50.	Differentially expressed genes (DEGs) (q-value <0.05) between different samples were identified using the stringtie version 1.3.0, followed by Cufflinks version 2.2.	WBPaper00059824:rnp-6(dh1127)_regulated_OP50
	Transcripts that showed significantly altered expression in rnp-6(dh1127) animals comparing to in N2 when fed with live S. aureus.	Differentially expressed genes (DEGs) (q-value <0.05) between different samples were identified using the stringtie version 1.3.0, followed by Cufflinks version 2.2.	WBPaper00059824:rnp-6(dh1127)_regulated_S.aureus
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts that showed significantly increased expression in lin-40(yth27);cco-1(RNAi) animals comparing to lin-40(yth27) animals injected with empty vector.	N.A.	WBPaper00060084:cco-1(RNAi)_upregulated_lin-40(yth27)
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	EdgeR v. 3.20.2, fold change > 2.	WBPaper00055941:nuo-6(qm200)_upregulated
	Genes regulated by DPY-21, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12.	Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons.	WBPaper00050801:DPY-21_dauer_regulome

14 Expression Patterns

• Primary Identifier: Expr1031277
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5685
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16086
• Reporter Gene: [kap-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCTCGTAAATCGGCTTCAA] 3' and primer B 5' [ATTGAGCTAAACACGGAAAATCA] 3'.
• Pattern: Adult Expression: intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr7980
• Remark: Picture: Fig. 4A.
• Pattern: Expressed in AWC neurons.

• Primary Identifier: Expr11120
• Pattern: Expressed in all ciliated neurons, including AWB.

• Primary Identifier: Expr1272
• Remark: kap-1 = CeKAP
• Pattern: High intensity of staining of the sensory cilia.
• Subcellular Localization: Stained the cell body cytoplasm, dendrites, and ciliated endings of the amphid, inner labial, and phasmid chemosensory neurons.

• Primary Identifier: Expr3029
• Remark: kap-1 = KAP in this paper.
• Pattern: KAP::GFP, OSM-1::GFP, and OSM-6::GFP fusion proteins are expressed in amphid and phasmid chemosensory neurons.
• Subcellular Localization: They appear to concentrate at the base of the transition zones, which correspond to the basal bodies of motile and sensory cilia. These fusion proteins are seen to emerge from the transition zones as small fluorescent particles that move in a bidirectional fashion along the sensory cilia, displaying anterograde movement from the transition zone toward the tip of the ciliary axoneme and retrograde movement from the cilium tip back toward the transition zone.

• Primary Identifier: Chronogram735
• Remark: Original chronogram file: chronogram.1767.xml
• Reporter Gene: [F08F8.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram727
• Remark: Original chronogram file: chronogram.1758.xml
• Reporter Gene: [F08F8.3:gfp] transcriptional fusion.

• Primary Identifier: Expr2012900
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1012490
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr15147
• Pattern: Consistent with redundant functions of these motors in building the AWA cilium, KAP-1::GFP and OSM-3::GFP could be detected throughout the AWA cilia in wild-type animals. However, KAP-1::GFP was preferentially enriched in the short proximal AWA ciliary stalk with low expression levels in the distal ciliary branches, whereas OSM-3::GFP accumulated strongly at the distal tips of the AWA ciliary branches. A GFP-tagged OSM-6 IFT-B fusion protein was also present at low levels throughout AWA cilia but was enriched in the proximal stalk similar to KAP-1::GFP.
• Subcellular Localization: Consistent with redundant functions of these motors in building the AWA cilium, KAP-1::GFP and OSM-3::GFP could be detected throughout the AWA cilia in wild-type animals. However, KAP-1::GFP was preferentially enriched in the short proximal AWA ciliary stalk with low expression levels in the distal ciliary branches, whereas OSM-3::GFP accumulated strongly at the distal tips of the AWA ciliary branches. A GFP-tagged OSM-6 IFT-B fusion protein was also present at low levels throughout AWA cilia but was enriched in the proximal stalk similar to KAP-1::GFP.

• Primary Identifier: Expr15052
• Subcellular Localization: The KAP-1 kinesin-2 motor component, OSM-3 homodimeric motor, and XBX-1 dynein light chain subunit were localized to the very distal ends of the URX dendrites.

• Primary Identifier: Expr1147994
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2031134
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

17 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002182
• Start: 7338835
• End: 7343667
• Strand: 1

17 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4833

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00031562
• WBStrain00003712

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_7338766..7338834
• Length (nt): 69
• Chromosome Location: III: 7338766-7338834
• Organism: Caenorhabditis elegans