WormMine: Gene WBGene00002980

• WormBase Gene ID: WBGene00002980
• Gene Name: lgg-1
• Sequence Name: C32D5.9
• Brief Description: lgg-1 encodes the C. elegans ortholog of Saccharomyces cerevisiae Atg8p and mammalian MAP-LC3; by homology, LGG-1 is predicted to be required for the degradation of cellular components by autophagy; loss of lgg-1 function via RNAi indicates that, like several other C. elegans genes involved in autophagy, lgg-1 is essential for normal dauer morphogenesis and life-span extension; a GFP::LGG-1 reporter fusion protein is expression in several different stages of development in multiple tissues, including the nervous system, pharynx, intestine, hypodermis, somatic gonad and vulva; under normal growth conditions, GFP::LGG-1 shows a diffuse cytoplasmic localization, but during dauer formation and in long-lived animals, GFP::LGG-1 shows a marked increase in punctate staining in hypodermal seam cells that likely reflects an increase in the number of preautophagosomal and autophagosomal structures.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable GABA receptor binding activity; phosphatidylethanolamine binding activity; and ubiquitin protein ligase binding activity. Involved in several processes, including dauer larval development; positive regulation of autophagosome assembly; and response to stress. Located in bounding membrane of organelle; neuron projection; and neuronal cell body. Expressed in several structures, including egg-laying apparatus; germ cell; hypodermis; intestine; and nervous system. Is an ortholog of human GABARAP (GABA type A receptor-associated protein).
• Biotype: SO:0001217
• Genetic Position: II :-0.380826 ±0.000183
• Length (nt): 760

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002980

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C32D5.9.1	C32D5.9.1	708	II: 6346960-6347719

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C32D5.9	C32D5.9	372	II: 6347263-6347346

60 RNAi Result

• WBRNAi00083909
• WBRNAi00083907
• WBRNAi00078273
• WBRNAi00086929
• WBRNAi00086903
• WBRNAi00086902
• WBRNAi00086904
• WBRNAi00086909
• WBRNAi00086908
• WBRNAi00086912
• WBRNAi00086917
• WBRNAi00086919
• WBRNAi00083904
• WBRNAi00083906
• WBRNAi00041674
• WBRNAi00083910
• WBRNAi00083912
• WBRNAi00011484
• WBRNAi00076184
• WBRNAi00093520
• WBRNAi00091343
• WBRNAi00086600
• WBRNAi00029419
• WBRNAi00093533
• WBRNAi00093536
• WBRNAi00113707
• WBRNAi00113911
• WBRNAi00108433
• WBRNAi00113703
• WBRNAi00102244

16 Allele

• gk963801
• gk963053
• tm3489
• bp523
• bp407
• gk941807
• WBVar01249951
• gk413287
• bp500
• gk484936
• WBVar00172605
• gk777923
• gk792260
• gk597252
• gk686585

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002980
• Start: 6346960
• End: 6347719
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_6345965..6346959
• Length (nt): 995
• Chromosome Location: II: 6345965-6346959
• Organism: Caenorhabditis elegans

170 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
Pheromone	Pheromone-induced transcripts that showed significantly decreased expression in post dauer animals comparing to wild type control.	edgeR	WBPaper00053713:Pheromone-induced_postdauer_vs_control_downregulated
Starvation	Starvation-induced transcripts that showed significantly increased expression in post dauer animals comparing to wild type control.	edgeR	WBPaper00053713:Starvation-induced_postdauer_vs_control_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed

17 Expression Patterns

• Primary Identifier: Expr4557
• Pattern: Expressed in touch receptor neurons, ventral cord neurons and the nerve ring in the head.
• Subcellular Localization: Expressed in the cell bodies and processes of neurons.

• Primary Identifier: Expr4558
• Remark: No GO_term assigned.
• Subcellular Localization: GFP::LGG-1 often accumulated in a punctate pattern in neurons showing early signs of vacuolization.

• Primary Identifier: Expr5398
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC13567
• Reporter Gene: [lgg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACTTTCAAGGCGACAGTA] 3' and primer B 5' [GCCCACTTGATTTTGATTCG] 3'.
• Pattern: Adult Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons

• Primary Identifier: Expr1031380
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr15105
• Pattern: mCherry::GFP::LGG-1 was expressed in several major tissues of adult WT animals such as intestine, body-wall muscle, pharynx, and nerve-ring neurons.

• Primary Identifier: Expr2695
• Pattern: Wild-type N2 and daf-2(e1370) animals carrying an extrachromosomal array that expressed GFP::LGG-1 had diffuse cytoplasmic GFP expression in multiple tissues in different stages of development, including the nervous system, pharynx, intestine, hypodermis, somatic gonad, and vulva. The tissue distribution of GFP::LGG-1 expression was similar to that observed for GFP regulated by the endogenous bec-1 promoter.
• Subcellular Localization: In N2 animals, similar numbers of GFP-positive punctate areas were observed during growth at 15 centigrade and at 25 centigrade. In contrast, there was a marked increase in the number of seam cell, GFP-positive, punctate areas in daf-2(e1370) animals during dauer formation at 25 centigrade as compared to during reproductive growth at 15 centigrade (P < 0.001, t-test). In non-dauser stages, GFP::LGG-1 had diffuse cytoplasmic GFP expression. During dauer formation, a marked change was observed in the subcellular localization pattern of GFP::LGG-1 in hypodermal seam cells.

• Primary Identifier: Expr9495
• Remark: Operon: CEOP2240
• Pattern: Adult Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons. Larval Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons
• Subcellular Localization: In non-dauer stages, GFP::LGG-1 had diffuse cytoplasmic GFP expression. During dauer formation, a marked change was observed in the subcellular localization pattern of GFP::LGG-1 in hypodermal seam cells. Sub-cellular localization within the body wall muscle: Nucleus and Cytoplasm/Other

• Primary Identifier: Expr16451
• Pattern: After immunostaining N2 adult worms using an anti-LGG-1 (rabbit) antibody, we found that LGG-1 was most prominently expressed in the intestine, body-wall muscle, nerve ring, vulva and tail.

• Primary Identifier: Expr14802
• Pattern: The expression patterns of functional translation reporters for the autophagy genes lgg-1, atg-18, epg-4, epg-5 and epg-9 were analyzed. These reporters were expressed in almost all cells at the embryonic stages. At the larval and adult stages, they were also widely distributed, including in hypodermis, body wall muscles, intestinal cells and cells in the head and tail regions. The intensity of the GFP signal, however, varied in different cell types. For example, levels of EPG-9::GFP were stronger in neurons than in hypodermis, intestine and muscle at the post-embryonic stages, while EPG-4::GFP was expressed more in the intestine than in muscle and hypoder-mal cells at the L4 larval stage. The expression patterns of functional translation reporters for the autophagy genes lgg-1, atg-18, epg-4, epg-5 and epg-9 were analyzed. These reporters were expressed in almost all cells at the embryonic stages. At the larval and adult stages, they were also widely distributed, including in hypodermis, body wall muscles, intestinal cells and cells in the head and tail regions. The intensity of the GFP signal, however, varied in different cell types. For example, levels of EPG-9::GFP were stronger in neurons than in hypodermis, intestine and muscle at the post-embryonic stages, while EPG-4::GFP was expressed more in the intestine than in muscle and hypodermal cells at the L4 larval stage.

• Primary Identifier: Expr2013142
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11433
• Pattern: Immunostaining revealed that LGG-1 is expressed in germ cells.

• Primary Identifier: Expr1200363
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr12742
• Pattern: Autophagy-related proteins, LGG-1, LGG-2, and BEC-1::GFP are expressed in a subset of cells within germline tumors.

• Primary Identifier: Expr2031374
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11488
• Subcellular Localization: LGG-1 is mainly associated with 250 nm diameter vesicular structures with a double membrane and cytoplasmic material content. These results are adirect evidence that LGG-1 labels autophagosomal membranes. Less frequently, flat or unclosed structures were labeled by LGG-1, suggesting that the protein is associated early during the elongation of autophagosome. In rare cases GFP-positive dots were also detected in the lumen of lysosomes, supporting the notion that LGG-1 labels autophagosomes during the whole autophagic flux, from isolation membrane to autolysosome.

• Primary Identifier: Expr1017039
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1145699
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

53 GO Annotation

12 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002980
• Start: 6346960
• End: 6347719
• Strand: -1

53 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 760

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00033311
• WBStrain00002645
• WBStrain00003898
• WBStrain00003955

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_6347720..6349206
• Length (nt): 1487
• Chromosome Location: II: 6347720-6349206
• Organism: Caenorhabditis elegans