WormMine: Gene WBGene00003169

• WormBase Gene ID: WBGene00003169
• Gene Name: mec-5
• Sequence Name: E03G2.3
• Brief Description: mec-5 encodes a collagen unique in the number of Gly-X-Y repeats and in the composition of amino acids surrounding these repeats; MEC-5 is required for normal mechanosensory response to gentle touch and for the proper functioning of the touch receptor neurons; mec-5 interacts genetically with mec-4 and mec-10 which encode degenerins (ion channels) expressed in the touch neurons, mec-9, which encodes a protein containing EGF-like and Kunitz/protease inhibitor domains secreted by the touch neurons, and mec-12, which encodes an alpha-tubulin expressed in the touch neurons; these genetic interactions suggest that MEC-5 may play a role in anchoring the degenerin complex to the extracellular matrix; MEC-5 is produced and secreted by hypodermal cells.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be an extracellular matrix structural constituent. Involved in positive regulation of multicellular organismal process and response to mechanical stimulus. Located in extracellular matrix. Expressed in head; hypodermis; muscle cell; tail; and touch receptor neurons.
• Biotype: SO:0001217
• Genetic Position: X :22.9942 ±0.006485
• Length (nt): 4944

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003169

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:E03G2.3.1	E03G2.3.1	1128	X: 15944009-15948952

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:E03G2.3	E03G2.3	984	X: 15944012-15944137

3 RNAi Result

• WBRNAi00043637
• WBRNAi00012667
• WBRNAi00027659

115 Allele

• gk964260
• gk962707
• gk963810
• gk963581
• gk665944
• gk575945
• gk758359
• gk427568
• gk460202
• gk408286
• gk735079
• gk785039
• gk394772
• gk846972
• gk506313
• gk597021
• gk853993
• gk713478
• gk839794
• gk586298
• gk550085
• gk425113
• gk914488
• gk318928
• gk355106
• gk326047
• gk613481
• gk686030
• gk441953
• gk585576

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003169
• Start: 15944009
• End: 15948952
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_15948953..15951493
• Length (nt): 2541
• Chromosome Location: X: 15948953-15951493
• Organism: Caenorhabditis elegans

158 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:sre-33-ZK1025.1_8337
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Enterococcus faecalis OG1RF. 16 hours of exposure after L4 larva stage at 25C.	Transcripts that showed significantly decreased expression in skpo-1(ok1640) animals fed by E. faecalis strain OG1RF for 16 hours after L4 larva stage at 25C.	DESeq2, fold change > 2.	WBPaper00061081:E.faecalis_downregulated_skpo-1(ok1640)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C.	Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00058948:PA14_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed

11 Expression Patterns

• Primary Identifier: Expr1031502
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5646
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11600
• Reporter Gene: [mec-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGGTTCAAAGAACAATTTAAGG] 3' and primer B 5' [TCATGAAAAGCTGTTGAAAACAA] 3'.
• Pattern: Adult Expression: Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: Nervous System; ventral nerve cord; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5647
• Remark: Strain: BC12900
• Reporter Gene: [mec-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGGTTCAAAGAACAATTTAAGG] 3' and primer B 5' [TCATGAAAAGCTGTTGAAAACAA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr1019868
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr3464
• Subcellular Localization: A full-length MEC-5 collagen fusion with GFP bound strongly to the processes of the touch receptor neurons in a pattern similar to that of MEC-1 (see Expr3463). Most of the lateral processes had a uniform fluorescence underlying periodic spots of brighter fluorescence. Only these puncta were seen at the ends of the ALM processes. The uniform fluorescence appears as two parallel lines that run along the neuronal process and that are independent of the angle of observation. This pattern suggests that MEC-5::GFP coats the axon. The ventral processes did not appear to have the uniform fluorescence, but had MEC-5::GFP puncta approximately 2 um apart. The puncta differ in intensity, with occasional puncta being much less intense. Although puncta on the lateral processes are spaced on average further apart, sometimes pairs of puncta are as close together as those on the ventral processes. MEC-5::GFP also adhered as puncta to the edge of the muscle cells and to what appear to be the muscle dense bodies. The cells also have large, randomly placed aggregates.

• Primary Identifier: Expr8329
• Remark: Picture: Fig 3, S1, Supplementary Video 1
• Subcellular Localization: Anti-MEC-4 and anti-MEC-2 antibodies decorated two structures in wild-type TRNs, the plasma membrane and the 15pf microtubules, whereas anti-MEC-5 antibodies decorated the space in between TRN neurites and the surrounding hypodermal cell. Approximately half of the MeT channel labels were associated with the plasma membrane: 51% (n = 49) and 44% (n = 36) of anti-MEC-2 and anti-MEC-4 labels, respectively). These labels were distributed around the circumference of the TRN neurite without any obvious bias for either the apical or basal aspect of the neurite. In some cases, clusters of gold labels were associated with the plasma membrane. Half of the membrane-associated anti-MEC-4 labels were doublets, whereas approximately one-fifth of the membrane-associated anti-MEC-2 labels contained clusters of 2 or 3 gold beads. Anti-MEC-5 antibodies were significantly more likely to be found on the apical side of TRN neurites. The remaining MeT channel labels were associated with 15pf microtubules distributed throughout the cytoplasm. Intracellular labels were not associated with vesicles in TRN neurites and vesicles were not detected in any of the five SS-IEM reconstructions, which covered a total length of 63 um.

• Primary Identifier: Expr8328
• Remark: Picture: Fig 1, Fig 2.
• Subcellular Localization: All three antibodies labeled TRN cell bodies and discrete puncta along the length of TRN neurites. MEC-2 and MEC-4 interpunctum intervals had similar distributions, including a significant proportion of intervals that were longer than 2 um. The distribution of MEC-5 intervals was more compact and no interval was longer than 2 um. On average, MEC-2 and MEC-4 IF puncta were separated by 2.6 +/-2.7 um (n = 498 intervals) and 1.7 +/- 1.9 m (n = 386 intervals), respectively, whereas MEC-5 IF puncta were separated by only 0.65 +/- 0.6 m (n = 421 intervals). Double-labeling experiments revealed that, whereas MEC-2 and MEC-4 IF puncta were colocalized, MEC-2 and MEC-5 IF puncta frequently occupied distinct domains of lateral neurites. Samples colabeled with polyclonal antibodies raised against MEC-2 in mouse and rabbit served as a control for the values expected for colocalized proteins. This analysis strongly supports the conclusion that MEC-2 colocalizes with MEC-4 but not with MEC-5.

• Primary Identifier: Expr1624
• Remark: Reporter gene fusion type not specified.
• Pattern: lacZ and gfp fusions with the mec-5 promoter (TU#233 and TU#234, respectively) and a lacZ fusion with part of the mec-5 coding sequence and a sequence for a synthetic transmembrane domain (TU#235) gave the same pattern of expression with strong expression by hypodermal cells. In newly hatched animals, MEC-5 is strongly expressed by seam cells (epidermal stem cells) along the body and by hypodermal cells in the head. As the animals mature and the seam cells divide, MEC-5 is expressed by both seam cells and their progeny, but at a lower level than in newly hatched larvae. In early L2 larvae, staining is also seen in the cells of the ventral hypodermis. Strong staining is limited to the head in adults.

• Primary Identifier: Expr2013499
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1147623
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2031733
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

27 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003169
• Start: 15944009
• End: 15948952
• Strand: 1

27 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4944

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00033093
• WBStrain00004465
• WBStrain00004349
• WBStrain00004304

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_15939325..15944008
• Length (nt): 4684
• Chromosome Location: X: 15939325-15944008
• Organism: Caenorhabditis elegans