WormMine: ExpressionPattern Expr5646

• Pattern: Adult Expression: Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: Nervous System; ventral nerve cord; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr5646
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11600
• Reporter Gene: [mec-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGGTTCAAAGAACAATTTAAGG] 3' and primer B 5' [TCATGAAAAGCTGTTGAAAACAA] 3'.

5 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
a bundle of nerve processes that runs along the dorsal mid-line of the animal.	dorsal nerve cord	dorsal cord	WBbt:0006750
posterior region, from rectum to the end	tail		WBbt:0005741
anterior-most body region containing the pharynx.	head		WBbt:0005739

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003169	mec-5	E03G2.3	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023