WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00003400 Gene Name  dapk-1
Sequence Name  ? K12C11.4 Brief Description  dapk-1 encodes the C. elegans ortholog of the tumor suppressor death-associated protein (DAP) kinase; dapk-1 functions in epidermal cells to regulate epithelial damage responses; specifically dapk-1 acts as a negative regulator of barrier repair and the TIR-1-mediated innate immune response to wounding; dapk-1 also functions downstream of, or in parallel to, muscarinic signaling in the regulation of starvation-induced autophagy; a dapk-1::gfp promoter fusion is expressed in epidermal cells beginning at the 3-fold stage of embryogenesis, and also in muscles and neurons.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in intracellular signal transduction and positive regulation of apoptotic process. Predicted to be located in nucleus. Human ortholog(s) of this gene implicated in urinary bladder cancer and uterine fibroid. Is an ortholog of human DAPK1 (death associated protein kinase 1).
Biotype  SO:0001217 Genetic Position  I :-14.7285 ±0.107728
Length (nt)  ? 23087
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00003400

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:K12C11.4a.1 K12C11.4a.1 4788   I: 1305562-1328648
Transcript:K12C11.4b.1 K12C11.4b.1 3795   I: 1308011-1328151
Transcript:K12C11.4c.1 K12C11.4c.1 3090   I: 1311009-1328151
Transcript:K12C11.4d.1 K12C11.4d.1 2784   I: 1316674-1328151
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:K12C11.4b K12C11.4b 3795   I: 1308011-1308198
CDS:K12C11.4c K12C11.4c 3090   I: 1311009-1311290
CDS:K12C11.4d K12C11.4d 2784   I: 1316674-1317180
CDS:K12C11.4a K12C11.4a 4278   I: 1305575-1305681

5 RNAi Result

WormBase ID
WBRNAi00034311
WBRNAi00050650
WBRNAi00003987
WBRNAi00076574
WBRNAi00116621

576 Allele

Public Name
gk963902
otn10588
gk963630
gk963701
gk938982
gk527402
WBVar00245656
WBVar01694377
WBVar01694376
WBVar01430125
WBVar01430124
WBVar01430129
WBVar01430128
WBVar01430127
WBVar01430126
WBVar01430132
WBVar01430131
WBVar01430130
WBVar01430134
WBVar01430133
WBVar01602728
WBVar01711571
WBVar02120904
WBVar01375156
WBVar01375267
WBVar01545707
WBVar01545708
WBVar01545709
WBVar01545704
WBVar01545705

1 Chromosome

WormBase ID Organism Length (nt)
I Caenorhabditis elegans 15072434  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00003400 1305562 1328648 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_1328649..1332697   4049 I: 1328649-1332697 Caenorhabditis elegans

102 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Coexpression clique No. 60, 176662_at-Y53F4B.16, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:176662_at-Y53F4B.16
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_oocyte_depleted
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. WBPaper00058958:100mGy-irradiation-72h_upregulated
Reduced humidity (98% relative humidity). Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis. Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001. WBPaper00044578:reduced-humidity_downregulated_microarray
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:excretory-cell_L2-larva_expressed
  Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:ubc-9(ne4833)_upregulated
  Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:germline-precursors_blastula-embryo_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1031570 Tiling arrays expression graphs  
Strain: BC12312 [K12C11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCTCTCCGATGGAACAAT] 3' and primer B 5' [GTGATCTGACATTTTGACGCAT] 3'. Expr6395 Adult Expression: body wall muscle; hypodermis; Larval Expression: body wall muscle; hypodermis;  
    Expr2010792 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1020396 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.1656.xml [K12C11.4:gfp] transcriptional fusion. Chronogram627    
    Expr1154362 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2029029 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

23 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables

11 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00003400 1305562 1328648 1

23 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables

1 Regulates Expr Cluster

Regulated By Treatment Description Algorithm Primary Identifier
  Genes upregulated in L4 larva of dapk-1(ju4) worms. The dapk-1 mutant transcriptional profile overlapped strikingly with that of animals infected with Drechmeria (19/303 genes in common with the top 419 Drechmeria-up-regulated. N.A. WBPaper00033131:dapk-1_upregulated

1 Sequence

Length
23087

1 Sequence Ontology Term

Identifier Name Description
gene  

5 Strains

WormBase ID
WBStrain00022150
WBStrain00022151
WBStrain00022152
WBStrain00035765
WBStrain00005350

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_1287960..1305561   17602 I: 1287960-1305561 Caenorhabditis elegans