WormMine: Gene WBGene00003931

• WormBase Gene ID: WBGene00003931
• Gene Name: pat-4
• Sequence Name: C29F9.7
• Brief Description: The pat-4 gene encodes a serine/threonine kinase orthologous to human integrin-linked kinase (ILK, OMIM:602366) and is required for formation of integrin-mediated muscle cell attachments during embryogenesis; PAT-4 probably functions as an adaptor molecule and localizes to dense bodies and M lines; PAT-4 forms a ternary complex with PAT-6/actopaxin and UNC-112, and requires UNC-112, UNC-52/perlecan, PAT-2/alpha integrin, and PAT-3/beta integrin for proper localization to newly forming integrin adhesion complexes.
• Organism: Caenorhabditis elegans
• Automated Description: Enables integrin binding activity and protein-macromolecule adaptor activity. Involved in several processes, including integrin-mediated signaling pathway; muscle cell cellular homeostasis; and positive regulation of supramolecular fiber organization. Located in adherens junction; basal plasma membrane; and contractile muscle fiber. Part of integrin complex. Expressed in body wall musculature; gonad; non-striated muscle; pharynx; and touch receptor neurons. Human ortholog(s) of this gene implicated in ovarian cancer; pancreatic cancer; and prostate adenocarcinoma. Is an ortholog of human ILK (integrin linked kinase).
• Biotype: SO:0001217
• Genetic Position: III :-26.9858 ±0.037333
• Length (nt): 5357

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003931

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C29F9.7.1	C29F9.7.1	1597	III: 89453-94809

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C29F9.7	C29F9.7	1401	III: 89643-89789

40 RNAi Result

• WBRNAi00078627
• WBRNAi00024673
• WBRNAi00041498
• WBRNAi00008463
• WBRNAi00029337
• WBRNAi00109188
• WBRNAi00116132
• WBRNAi00112361
• WBRNAi00077522
• WBRNAi00112552
• WBRNAi00085343
• WBRNAi00071243
• WBRNAi00091714
• WBRNAi00071697
• WBRNAi00086102
• WBRNAi00022994
• WBRNAi00109286
• WBRNAi00081073
• WBRNAi00091729
• WBRNAi00109480
• WBRNAi00066199
• WBRNAi00091669
• WBRNAi00002692
• WBRNAi00063955
• WBRNAi00063956
• WBRNAi00114632
• WBRNAi00083949
• WBRNAi00091744
• WBRNAi00112553
• WBRNAi00112555

312 Allele

• gk962532
• gk964281
• WBVar02122373
• WBVar02124464
• WBVar01697900
• WBVar01697901
• WBVar01697902
• WBVar01697907
• WBVar01697908
• WBVar01697909
• WBVar01697903
• WBVar01697904
• WBVar01697905
• WBVar01697906
• WBVar01697910
• WBVar01697911
• WBVar01697912
• WBVar01697913
• WBVar01697918
• WBVar01697919
• WBVar01697914
• WBVar01697915
• WBVar01697916
• WBVar01697917
• WBVar01697921
• WBVar01697922
• WBVar01697923
• WBVar01697924
• WBVar01697920
• WBVar01697925

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003931
• Start: 89453
• End: 94809
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_89244..89452
• Length (nt): 209
• Chromosome Location: III: 89244-89452
• Organism: Caenorhabditis elegans

143 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated

10 Expression Patterns

• Primary Identifier: Expr5379
• Remark: Strain: BC13546
• Reporter Gene: [pat-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATTTACAGATCTTTTGGGCAC] 3' and primer B 5' [CGACAAAGAGATTGTTGACTGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; vulval muscle; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr1031864
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1888
• Remark: Immunostaining experiments using anti-PAT-4/ILK show an identical localization pattern in wild-type embryos and adults.
• Pattern: The pat-4::gfp transgene is initially expressed weakly throughout postgastrulation embryos. By 420 min postfertilization, PAT-4/ILK::GFP is primarily observed in the body-wall muscle cells, where it colocalizes with the integrin PAT-3 subunit. pat-4::gfp is also transiently expressed in the pharynx during embryogenesis. In adult hermaphrodites, pat-4::gfp expression is observed in body-wall muscle cells, the spermatheca, the vulva muscles, a subset of the mechanosensory neurons (ALM, AVM, PLM, and PVM), the distal tip cells, the uterine muscles, and the anal depressor and anal sphincter muscles.
• Subcellular Localization: In adult body-wall muscle cells, PAT-4/ILK::YFP colocalizes with a functional PAT-3::CFP integrin subunit in M-lines and dense bodies and at muscle-muscle adherent junctions. PAT-4/ILK::GFP is located near the cell membrane and does not extend very deeply into body-wall muscle cells.

• Primary Identifier: Expr11437
• Pattern: The expression of pat-4/ILK was examined specifically in AFD and AIY neurons by using a transcriptional pat-4p::gfp reporter construct (Dupuy et al. 2007) expressed in combination with gcy- 8p::mCherry or ttx-3p::rfp constructs. Surprisingly, pat-4p::gfp was neither expressed in AFD nor in AIY neurons, but was present in adjacent cells, which may be ADF and/or AIM neurons (chemosensory/oxygencsensory neurons and interneurons, respectively). In addition expression was observed in body-wall muscle and in the gonad, as previously described (Mackinnon et al. 2002).

• Primary Identifier: Chronogram438
• Remark: Original chronogram file: chronogram.1447.xml
• Reporter Gene: [C29F9.7:gfp] transcriptional fusion.

• Primary Identifier: Expr1145524
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2014752
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr14519
• Subcellular Localization: PAT-4/ILK is located at the basal membrane with integrin and is distributed in a linear punctate pattern that runs the length of the muscle cells. UNC-97 colocalizes with the several other proteins (such as PAT-4/ILK, UNC-112 and integrin) at the dense body and M-line (adhesion complexes).

• Primary Identifier: Expr2032986
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1010218
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

41 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003931
• Start: 89453
• End: 94809
• Strand: -1

41 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5357

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00033521
• WBStrain00040330
• WBStrain00002637

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_94810..96782
• Length (nt): 1973
• Chromosome Location: III: 94810-96782
• Organism: Caenorhabditis elegans