WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00003997 Gene Name  pgp-3
Sequence Name  ? ZK455.7 Brief Description  pgp-3 encodes a transmembrane protein that is a member of the P-glycoprotein subclass of the ATP-binding cassette (ABC) transporter superfamily; with PGP-1, PGP-3 is required for defense against the pathogenic Pseudomonas aeruginosa strain PA14, and may facilitate ATP-dependent efflux of the toxic phenazine compounds produced by the bacteria; PGP-3 is also required for resistance to colchicine and chloroquine; PGP-3 is expressed in the apical membranes of the excretory cell and the intestinal cells.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable ATPase-coupled transmembrane transporter activity and efflux transmembrane transporter activity. Involved in defense response to Gram-negative bacterium; innate immune response; and stress response to cadmium ion. Located in apical plasma membrane. Expressed in excretory canal; excretory cell; intestinal cell; intestine; and pharynx. Human ortholog(s) of this gene implicated in several diseases, including carcinoma (multiple); inflammatory bowel disease (multiple); and intrahepatic cholestasis (multiple). Is an ortholog of several human genes including ABCB1 (ATP binding cassette subfamily B member 1); ABCB11 (ATP binding cassette subfamily B member 11); and ABCB4 (ATP binding cassette subfamily B member 4).
Biotype  SO:0001217 Genetic Position  X :3.16596 ±0.03869
Length (nt)  ? 4939
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00003997

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:ZK455.7.1 ZK455.7.1 3900   X: 11352156-11357094
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:ZK455.7 ZK455.7 3807   X: 11352162-11352263

4 RNAi Result

WormBase ID
WBRNAi00001488
WBRNAi00059437
WBRNAi00022018
WBRNAi00014821

77 Allele

Public Name
gk964260
gk964029
gk962707
gk964028
gk963810
WBVar01759457
WBVar01690457
WBVar01690456
WBVar01690459
WBVar01690458
WBVar01602186
WBVar01602185
gk962656
gk962655
tm11204
WBVar02009123
WBVar02009122
WBVar01471131
WBVar01471129
WBVar01620568
tm7881
gk294002
gk294001
gk294000
gk293999
gk293998
gk294010
gk294009
gk294008
gk294007

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00003997 11352156 11357094 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_11357095..11357815   721 X: 11357095-11357815 Caenorhabditis elegans

193 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts that showed significantly increased expression in hsf-1(sy441) vs. in N2 day 1 adults without heat shock. edgeR, fold change > 2, FDR < 0.05 WBPaper00066900:hsf-1(sy441)_upregulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_aging
  Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_aging
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
  mRNAs that showed differential expression in activated AAK-2(uthIs202[aak-2 (intron 1)::aak-2(aa1-aa321)::Tomato::unc-54 3'UTR + rol-6(su1006)]), activiated CRTC-1 (uthEx222[crtc-1p::crtc-1 cDNA (S76S, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]), or AAK-2;CRTC-1 comparing to in N2. Genes were tested for differential expression between each mutant strain and wild-type using edgeRs glm method. Briefly, negative binomial models were fitted and dispersion estimates obtained. These were then used to calculate average levels of change between conditions and determine differential expression, using the generalized linear model likelihood ratio test. For each comparison, genes with less than 5 CPM were filtered and those with at least 50% change and False Discovery Rate (FDR) of 1% or less were considered differentially expressed. WBPaper00046499:AMPK_regulated
Dietary restriction Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition. Bioconductor package edgeR, p < 0.05. WBPaper00056443:DietaryRestriction_downregulated
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:clk-1(qm30)_upregulated
  Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day10_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly decreased expression in N2 day 15 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day15_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:Cisplatin_downregulated_WT
  Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:sek-1(km4)_downregulated_cisplatin
  Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection. DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1. WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated

13 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4621 Expressed in: excretory cell and intestine.  
Species: C. briggsae.   Expr4622 In C. briggsae, the gene expressed in: excretory cell and intestine.  
    Expr1031913 Tiling arrays expression graphs  
    Expr1162864 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1549 pgp-3 is mainly expressed in the apical membrane of the large H-shaped excretory cell. Staining was also found in the apical membrane of intestinal cells and in the membrane of the most anterior region of the pharynx. Staining was localized in the membrane towards the luminal side of the canals and in the sinus of the cell body.
Strain: BC10257 [pgp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGCATAAAAGTGCACAAAAA] 3' and primer B 5' [aatggtcaaaatgaaagaaaacg] 3'. Expr7214 Adult Expression: intestine; Reproductive System; vulval muscle; excretory cell; Larval Expression: intestine; excretory cell;  
Reporter gene fusion type not specified.   Expr1547 Active in the intestinal cells.  
This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).   Expr749 Staining of large nuclei localized alongside intestine, posteriorly of the pharyngo-intestinal valve and anteriorly of the anus. In some experiments staining of a few parapharyngeal nuclei in 1/10 transgene (pPd26pgp3.XX) is observed. Reproducible staining is limited to the intestine with some variation in the number of cells that stain and in intensity. pPD26pgp3.XX strains are detectable in embryonic intestinal cells. Most uniform staining seen in early larval stages. The fraction of L3 and L4 and adult animals that are stained is smaller and staining is of less intensity. Nuclei of anterior-most ring of four cells and of the posterior four-six cells are usually more heavily stained than nuclei of other cells.  
    Expr3343 Expressed in excretory cell, gut, 4 isolates.  
    Expr10411 Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/  
    Expr3342 Expressed weakly in adult excretory cell, 2 isolates.  
    Expr2033105 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2014870 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

21 GO Annotation

Annotation Extension Qualifier
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables

4 Homologues

Type
orthologue
orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00003997 11352156 11357094 1

21 Ontology Annotations

Annotation Extension Qualifier
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
4939

1 Sequence Ontology Term

Identifier Name Description
gene  

6 Strains

WormBase ID
WBStrain00004731
WBStrain00028887
WBStrain00028888
WBStrain00028891
WBStrain00033025
WBStrain00037266

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_11350248..11352155   1908 X: 11350248-11352155 Caenorhabditis elegans