WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00004698 Gene Name  rsp-1
Sequence Name  ? W02B12.3 Brief Description  rsp-1 encodes the C. elegans ortholog of the vertebrate SRp75 splicing factor and member of the SR protein family of nuclear phosphoproteins that are required for constitutive splicing and influence alternative splicing regulation.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable RNA binding activity. Involved in gonad development; regulation of growth rate; and spermatogenesis. Located in nucleus. Expressed in several structures, including intestine and pharyngeal neurons. Human ortholog(s) of this gene implicated in several diseases, including Down syndrome; Huntington's disease; and carcinoma (multiple). Is an ortholog of human SRSF5 (serine and arginine rich splicing factor 5) and SRSF6 (serine and arginine rich splicing factor 6).
Biotype  SO:0001217 Genetic Position  II :3.47191 ±0.001984
Length (nt)  ? 2503
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00004698

Genomics

6 Transcripts

Class WormMine ID Sequence Name Length (nt) Chromosome Location
NcPrimaryTranscript Transcript:W02B12.3d W02B12.3d 2243   II: 11453362-11455807
MRNA Transcript:W02B12.3b.3 W02B12.3b.3 1515   II: 11453974-11455819
MRNA Transcript:W02B12.3b.1 W02B12.3b.1 1395   II: 11453980-11455808
MRNA Transcript:W02B12.3b.2 W02B12.3b.2 1545   II: 11453980-11455808
MRNA Transcript:W02B12.3a.1 W02B12.3a.1 1171   II: 11453980-11455864
MRNA Transcript:W02B12.3c.1 W02B12.3c.1 935   II: 11454672-11455808
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:W02B12.3b W02B12.3b 447   II: 11453981-11454103
CDS:W02B12.3c W02B12.3c 513   II: 11454919-11454921
CDS:W02B12.3a W02B12.3a 939   II: 11453981-11454103

28 RNAi Result

WormBase ID
WBRNAi00081504
WBRNAi00054556
WBRNAi00066331
WBRNAi00063945
WBRNAi00066330
WBRNAi00066413
WBRNAi00066414
WBRNAi00019488
WBRNAi00068303
WBRNAi00036173
WBRNAi00066329
WBRNAi00068300
WBRNAi00068276
WBRNAi00068277
WBRNAi00068278
WBRNAi00068279
WBRNAi00068281
WBRNAi00068283
WBRNAi00068284
WBRNAi00068285
WBRNAi00068286
WBRNAi00068293
WBRNAi00068298
WBRNAi00068295
WBRNAi00062395
WBRNAi00081529
WBRNAi00066336
WBRNAi00069873

33 Allele

Public Name
gk963801
gk963053
gk962684
gk963539
gk963482
tm722
WBVar01935665
gk448823
gk856300
WBVar01244881
gk880877
gk429352
gk596498
gk784540
gk362287
gk346685
WBVar00238675
gk651697
gk605578
gk507290
gk826346
gk657808
gk756632
gk460358
gk717351
gk155172
gk155171
gk155174
WBVar02033597
WBVar02108158

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00004698 11453362 11455864 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

160 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  oocyte proteins identified by two or more unique peptides during proteomics study. In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. WBPaper00038289:oocyte_protein
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_N2
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
  Transcripts expressed in vulva. FPKM >= 1. WBPaper00064122:vulva_transcriptome
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Top 300 transcripts enriched in ABalppppppa, ABpraaapppa according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:ASE_parent
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. WBPaper00058958:100mGy-irradiation-72h_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
Temprature shift to 28C for 24 hours. Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours. Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_48h_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC15342 [rsp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAGAGAGAAAGAGAGAGACGCAC] 3' and primer B 5' [GCTGAAAAGAAAGCGAATGAAT] 3'. Expr6818 Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; Reproductive System; developing vulva; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  
    Expr1032318 Tiling arrays expression graphs  
Other strain-- UL740   Expr151 Diffuse staining in embryos and larvae is located at the anterior of the worm. Diffuse staining is seen in embryos, young larvae and adults. The diffuse staining in embryos and larvae is located at the anterior of the worm. In adults staining is occasionally more nuclear localised and can be seen to reside in neuronal nuclei surrounding the pharynx and nuclei of the anterior intestine. This gene is homologous to pre-mRNA splicing factor-like proteins. In adults staining is generally nuclear localised and can be seen to reside in neuronal nuclei surrounding the pharynx and nuclei of the anterior intestine.  
Author used non-standard locus name in the article. rsp-1 is called srp-5 in the article. Reporter gene fusion type not specified.   Expr1143 GFP fluorescence began to be detected as early as 20-30 cell stage of embryogenesis, and was confined to almost all somatic nuclei in adult hermaphrodites. nuclei
    Expr1158105 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2015558 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1011101 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2033793 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

17 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  located_in
  located_in
  involved_in
  located_in
  involved_in
  involved_in

1 Homologues

Type
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00004698 11453362 11455864 1

17 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  located_in
  located_in
  involved_in
  located_in
  involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
2503

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00003456

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_11452956..11453361   406 II: 11452956-11453361 Caenorhabditis elegans