WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00006001 Gene Name  srx-110
Sequence Name  ? C46E10.6 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in PHBL and PHBR. Biotype  SO:0001217
Genetic Position  II :-6.21938 ±6.4e-05 Length (nt)  ? 1398
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00006001

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C46E10.6.1 C46E10.6.1 951   II: 3709555-3710952
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C46E10.6 C46E10.6 951   II: 3709555-3709620

2 RNAi Result

WormBase ID
WBRNAi00042601
WBRNAi00012032

35 Allele

Public Name
gk963801
gk963053
gk964038
WBVar02123020
WBVar02123884
gk877483
WBVar02012066
gk941542
gk637142
gk583555
gk317396
gk400019
gk750388
gk735179
gk382545
gk690747
WBVar01237323
WBVar01303562
WBVar01237322
gk139056
gk139055
gk139058
gk139057
WBVar01626244
WBVar01626245
WBVar01245884
gk139054
gk655643
gk139060
gk567222

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00006001 3709555 3710952 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_3710953..3711290   338 II: 3710953-3711290 Caenorhabditis elegans

21 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_18
Reduced humidity (98% relative humidity). Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis. Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001. WBPaper00044578:reduced-humidity_downregulated_microarray
  Genes with significantly increased expression in eat-2(ad465) treated with 2% DMSO for 72 hours, comparing to in N2 treated with 2% DMSO for 72 hours. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:eat-2(ad465)_upregulated_in-DMSO
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Significantly downregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:cyc-1(RNAi)_downregulated
  Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells). Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations. WBPaper00025141:unc-4::GFP_Expressed_Genes
  Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C. N.A. WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
  Transcripts that showed significantly decreased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_downregulated_neuron
  Transcripts that showed significantly decreased expression in daf-2(e1370) comparing to in N2. Student's t-test, fold change > 2, p-value < 0.05. WBPaper00055386:daf-2(e1370)_downregulated
  Genes predicted to be upregulated more than 2.0 fold in rrf-2(ok210) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rrf-2(ok210)_upregulated
  Genes that showed significant differential expressed between control and 1000 mg\/L Fluoranthene treatment. t-test, p < 0.05. WBPaper00036123:Fluoranthene_regulated
  Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-21-srh-32
  Genes predicted to be upregulated more than 2.0 fold in rde-3(r459) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rde-3(r459)_upregulated
  Genes predicted to be upregulated more than 2.0 fold in rrf-1(pk1417) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rrf-1(pk1417)_upregulated
  Genes predicted to be upregulated more than 2.0 fold in rde-3(ne298) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rde-3(ne298)_upregulated
  Single-cell RNA-Seq cell group 99_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:99_0

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Expression is is seen from L3 stage and onward Strain: BC16049 [srx-110::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCAGGTGAAACTGGATCG] 3' and primer B 5' [AGTTACTCAAAAACATGGAAGTGA] 3'. Expr5515 Adult Expression: Nervous System; tail neurons; phasmids; Larval Expression: Nervous System; tail neurons; phasmids;  
    Expr2034977 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1032532 Tiling arrays expression graphs  
    Expr14187 PHB  
    Expr1146584 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2016802 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1018809 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00006001 3709555 3710952 1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1398

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00062391
WBStrain00003701

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_3709222..3709554   333 II: 3709222-3709554 Caenorhabditis elegans