WormMine: Gene WBGene00006527

• WormBase Gene ID: WBGene00006527
• Gene Name: tax-6
• Sequence Name: C02F4.2
• Brief Description: tax-6 encodes an ortholog of calcineurin A that is required for inhibition and adaptation of several sensory neurons and for the normal regulation of egg-laying by serotonin; TAX-6 stimulates transcription of rcn-1, and binds RCN-1 protein if free Ca[2+] is present; in general, calcineurin positively regulates calcium-dependent signaling; tax-6 loss-of-function mutants exhibit an extended lifespan which is characterized by enhanced autophagy and dependent upon the presence of functional bec-1.
• Organism: Caenorhabditis elegans
• Automated Description: Enables calcium ion binding activity and calmodulin-dependent protein phosphatase activity. Involved in several processes, including determination of adult lifespan; male mating behavior; and response to temperature stimulus. Located in several cellular components, including neuronal cell body; nucleus; and plasma membrane bounded cell projection. Expressed in several structures, including germ line; head neurons; muscle cell; tail neurons; and ventral nerve cord. Human ortholog(s) of this gene implicated in several diseases, including aortic valve stenosis; cholangiocarcinoma; and developmental and epileptic encephalopathy 91. Is an ortholog of human PPP3CB (protein phosphatase 3 catalytic subunit beta) and PPP3CC (protein phosphatase 3 catalytic subunit gamma).
• Biotype: SO:0001217
• Genetic Position: IV :4.61426 ±0.001167
• Length (nt): 8732

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006527

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C02F4.2a.1	C02F4.2a.1	2852	IV: 10492869-10501599
Transcript:C02F4.2a.2	C02F4.2a.2	2668	IV: 10492869-10501127
Transcript:C02F4.2c.1	C02F4.2c.1	2874	IV: 10492869-10501600
Transcript:C02F4.2c.2	C02F4.2c.2	2690	IV: 10492869-10501128
Transcript:C02F4.2b.1	C02F4.2b.1	1638	IV: 10493862-10501060

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C02F4.2b	C02F4.2b	1638	IV: 10493862-10494052
CDS:C02F4.2a	C02F4.2a	1608	IV: 10493862-10494052
CDS:C02F4.2c	C02F4.2c	1629	IV: 10493862-10494052

12 RNAi Result

• WBRNAi00039438
• WBRNAi00066726
• WBRNAi00028353
• WBRNAi00115258
• WBRNAi00008325
• WBRNAi00093956
• WBRNAi00093930
• WBRNAi00093881
• WBRNAi00023026
• WBRNAi00023124
• WBRNAi00023636
• WBRNAi00066528

103 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• WBVar02021136
• gk946561
• gk946562
• ok491
• h17631
• db44
• db60
• jh107
• WBVar01453966
• ok2065
• WBVar01904468
• ttTi7395
• gk842950
• gk476196
• gk754970
• gk817555
• gk878141
• gk382935
• gk856439
• WBVar02037101
• gk698186
• gk866147
• gk557744
• WBVar02037100
• gk674606
• gk850105

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006527
• Start: 10492869
• End: 10501600
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

193 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria infection: Photorhabdus luminescens	Genes down-regulated in animals infected with Photorhabdus luminescens compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Photorhabdus_luminescens_downregulated
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Expression Pattern Group C, enriched for genes involved in metabolic processes.	The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05.	WBPaper00036286:Pattern_C
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome

20 Expression Patterns

• Primary Identifier: Expr4792
• Pattern: TAX-6::GFP was expressed in neurons and in the cytoplasm and nucleus of intestinal cells.
• Subcellular Localization: Expressed in the cytoplasm and nucleus of intestinal cells.

• Primary Identifier: Expr2035443
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5113
• Remark: Strain: BC10435
• Reporter Gene: [tax-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCATCCTCTCTCATTTCCCT] 3' and primer B 5' [GATGTCGAGGCGATTGTGT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Nervous System; nerve ring; head neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr1824
• Remark: Cells expressing TAX-6 were visualized using several tax-6::gfp fusion genes. The expression of tax-6 is under diverse transcriptional controls. Reporter gene fusion type not specified. pAK43 is a larger transgene that should include all promoter regions for tax-6 transcription, since another gene is encoded just upstream of this region and tax-6 mRNA does not seem to be derived from a polycistronic transcript.
• Pattern: When introduced into wildtype animals, pAK43 drove TAX-6 expression in many sensory neurons, as well as interneurons including AIY and AIZ, and most, if not all, muscle cells. pAK43 is expressed in muscle, AIB, AIY, AIZ, RIA, RIB, RIS, RIM, ASI, ADF, ASH, ASK, ADL, AUA, PHA, PHB, AVE. It is also expressed in AFD, ASE, AWA, AWC, AVK, AIM, RMDV, AVA.

• Primary Identifier: Expr3707
• Pattern: TAX-6 is found in muscles, ventral cord neurons and the ventral cord processes.
• Subcellular Localization: TAX-6 is cytosolic, thus it does not appear in clusters (like UNC-38), but uniformly along the nervecord.

• Primary Identifier: Expr1823
• Remark: Cells expressing TAX-6 were visualized using several tax-6::gfp fusion genes. The expression of tax-6 is under diverse transcriptional controls. Introducing pAK13 into tax-6 mutants rescued thermotaxis and all other defects.
• Pattern: pAK13 drove TAX-6 expression mostly in sensory neurons, including the thermosensory AFD neurons, the chemosensory ASE, AWA, and AWC neurons, and the osmosensory ASH neurons. pAK13 is expressed in ASI, ADF, ASH, ASK, ADL, AUA, PHA, PHB, AVE. It is also expressed in AFD, ASE, AWA, AWC, AVK, AIM, RMDV, AVA.
• Subcellular Localization: TAX-6 appears to be expressed in the entire cytoplasm of these neurons. In head sensory neurons, for example, GFP fluorescence was visible at sensory cilia, dendrites, axons, and cell bodies.

• Primary Identifier: Expr1825
• Remark: Cells expressing TAX-6 were visualized using several tax-6::gfp fusion genes. The expression of tax-6 is under diverse transcriptional controls. Reporter gene fusion type not specified.
• Pattern: Both pAK5 and pAK6 failed to drive TAX-6 expression in AFD thermosensory neurons or chemosensory neurons such as ASE, AWA, and AWC. Compare with Expr1823 and Expr1824. pAK5 and pAK6 are expressed in ASI, ADF, ASH, ASK, ADL, AUA, PHA, PHB, AVE.

• Primary Identifier: Chronogram11
• Remark: Original chronogram file: chronogram.1007.xml
• Reporter Gene: [C02F4.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1032678
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr3673
• Pattern: The strong expression of tax-6 was observed in the intestinal muscle and the anal depressor muscle but not in the sphincter muscle.

• Primary Identifier: Expr3057
• Remark: Reporter gene fusion type not specified. tax-6 is called cna-1 in this article.
• Pattern: Both cna-1 and cnb-1 green fluorescent protein (gfp) reporter transgene expressions were detected at all developmental stages starting from early comma stage embryos to adult stages. Calcineurin also expresses in vulval muscle, body-wall muscle, and in a majority of neuronal cell bodies in the head and tail. Distinct expressions of calcineurin have also been detected in hypodermal seam cells / hypodermal tissue that is required for cuticle formation. Calcineurin also expresses in the male germline, and therefore may have possible roles in germline development. Expr1825 has shown calcineurin to express specifically in sensory neurons and interneurons including muscle cells.

• Primary Identifier: Expr1994
• Remark: tax-6 is called cna-1 in this article.
• Pattern: CNA-1 localization was also confirmed in the spermatheca by immunostaining isolated gonads. Similar localization to GFP expression patterns and additionally showed localization in hypodermal seam cells. See Expr1992 for cna-1::gfp expression patterns.
• Subcellular Localization: Wildtype male sperm was examined and immunostained with antiCNA-1 antibody. As expected, robust staining was observed in the wild-type sperm and the staining was distinctly cytoplasmic.

• Primary Identifier: Expr3313
• Remark: Reporter gene fusion type not specified.
• Pattern: Strong GFP expression as well as immunostaining of TAX-6 in hypodermal seam cells was detected.

• Primary Identifier: Expr1992
• Remark: tax-6 is called cna-1 in this article.
• Pattern: Expressed in diverse tissues. Expression was detected at all stages of development starting from early comma stage embryos to adult stages. Calcineurin is expressed in vulval muscle, body-wall muscle, spermatheca, and in a majority of neuronal cell bodies in the head and tail similar to previously obtained results.
• Subcellular Localization: neuronal cell bodies

• Primary Identifier: Expr1143553
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017308
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1027545
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1318
• Remark: Original chronogram file: chronogram.250.xml
• Reporter Gene: [C02F4.2:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1807
• Remark: Original chronogram file: chronogram.719.xml
• Reporter Gene: [C02F4.2:gfp] transcriptional fusion.

• Primary Identifier: Chronogram2031
• Remark: Original chronogram file: chronogram.941.xml
• Reporter Gene: [C02F4.2:gfp] transcriptional fusion.

66 GO Annotation

14 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006527
• Start: 10492869
• End: 10501600
• Strand: -1

66 Ontology Annotations

4 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes down regulated in tax-6(ok2065) comparing to in N2.	To identify genes that were significantly differentially expressed between each mutant and the control, linear modelling and empirical Bayes analysis was performed using the limma package. Limma computes an empirical Bayes adjustment for the t-test (moderated t-statistic), which is more robust than the standard two-sample t-test comparisons. To correct for multiple testing, Benjamin and Hochbergs method to control for false discovery rate was used. Genes with an adjusted P value of 0.05 or smaller and a fold-change in expression larger than twofold were considered differentially expressed.	WBPaper00038172:tax-6null_down_regulated
	Genes up regulated in tax-6(ok2065) comparing to in N2.	To identify genes that were significantly differentially expressed between each mutant and the control, linear modelling and empirical Bayes analysis was performed using the limma package. Limma computes an empirical Bayes adjustment for the t-test (moderated t-statistic), which is more robust than the standard two-sample t-test comparisons. To correct for multiple testing, Benjamin and Hochbergs method to control for false discovery rate was used. Genes with an adjusted P value of 0.05 or smaller and a fold-change in expression larger than twofold were considered differentially expressed.	WBPaper00038172:tax-6null_up_regulated
	Proteins down-regulated more than twofold in tax-6(jh107) mutants.	The gel image was analyzed with Melanie IV software (GeneBio,Geneva, Switzerland). Variance analysis of spot volume and comparisons of mean values of samples from mutant vs. wild-type worms were performed using SAS statistical software, with a significance level of p < 0.05.	WBPaper00027022:tax-6(jh107)_downregulated
	Proteins up-regulated more than twofold in tax-6(jh107) mutants.	The gel image was analyzed with Melanie IV software (GeneBio,Geneva, Switzerland). Variance analysis of spot volume and comparisons of mean values of samples from mutant vs. wild-type worms were performed using SAS statistical software, with a significance level of p < 0.05.	WBPaper00027022:tax-6(jh107)_upregulated

1 Sequence

• Length: 8732

1 Sequence Ontology Term

• Name: gene

7 Strains

• WBStrain00023527
• WBStrain00030784
• WBStrain00031450
• WBStrain00032360
• WBStrain00002840
• WBStrain00001440
• WBStrain00001429

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_10501601..10502283
• Length (nt): 683
• Chromosome Location: IV: 10501601-10502283
• Organism: Caenorhabditis elegans