WormMine: Gene WBGene00008419

• WormBase Gene ID: WBGene00008419
• Gene Name: wdr-23
• Sequence Name: D2030.9
• Brief Description: wdr-23 encodes a WD40 repeat-containing protein; WDR-23 functions as part of a CUL-4/DDB-1 ubiquitin ligase complex that negatively regulates accumulation and hence, transcriptional activation activity of the SKN-1 transcription factor in intestinal nuclei; wdr-23 activity is thus required for regulation of stress resistance, longevity, and normal growth and development; WDR-23 physically interacts with DDB-1 and SKN-1, thus likely serving as a bridge between the ubiquitin ligase complex and its SKN-1 substrate; in regulating skn-1 function, wdr-23 appears to act downstream of the p38 MAPK pathway and together with gsk-3 and the daf-2-mediated insulin signaling pathway; WDR-23 is expressed in the intestine, hypodermis, and neurons, where it localizes to nuclei.
• Organism: Caenorhabditis elegans
• Automated Description: Enables RNA polymerase II-specific DNA-binding transcription factor binding activity. Involved in several processes, including determination of adult lifespan; negative regulation of cellular response to manganese ion; and negative regulation of transcription by RNA polymerase II. Located in several cellular components, including intracellular membrane-bounded organelle; neuronal cell body; and striated muscle dense body. Expressed in ASIL; ASIR; head; muscle cell; and tail. Is an ortholog of human DCAF11 (DDB1 and CUL4 associated factor 11).
• Biotype: SO:0001217
• Genetic Position: I :2.19591 ±0.005029
• Length (nt): 6446

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00008419

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:D2030.9a.2	D2030.9a.2	2784	I: 7595776-7602221
Transcript:D2030.9c.1	D2030.9c.1	2018	I: 7596505-7602208
Transcript:D2030.9a.1	D2030.9a.1	2053	I: 7596507-7602221
Transcript:D2030.9b.1	D2030.9b.1	2057	I: 7597014-7602207
Transcript:D2030.9d.1	D2030.9d.1	1497	I: 7598353-7601903
Transcript:D2030.9e.1	D2030.9e.1	1473	I: 7598353-7601903

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:D2030.9a	D2030.9a	1716	I: 7596526-7596610
CDS:D2030.9c	D2030.9c	1692	I: 7596526-7596610
CDS:D2030.9b	D2030.9b	1593	I: 7597174-7597212
CDS:D2030.9d	D2030.9d	1497	I: 7598353-7598436
CDS:D2030.9e	D2030.9e	1473	I: 7598353-7598436

54 RNAi Result

• WBRNAi00043478
• WBRNAi00024956
• WBRNAi00024957
• WBRNAi00003290
• WBRNAi00024958
• WBRNAi00088187
• WBRNAi00080766
• WBRNAi00088310
• WBRNAi00080771
• WBRNAi00030405
• WBRNAi00113319
• WBRNAi00113090
• WBRNAi00066175
• WBRNAi00080781
• WBRNAi00116912
• WBRNAi00115100
• WBRNAi00112401
• WBRNAi00060412
• WBRNAi00060413
• WBRNAi00060414
• WBRNAi00060415
• WBRNAi00060416
• WBRNAi00060417
• WBRNAi00060418
• WBRNAi00060419
• WBRNAi00060420
• WBRNAi00113144
• WBRNAi00106801
• WBRNAi00080753
• WBRNAi00080756

96 Allele

• gk962858
• gk962706
• gk963902
• gk963871
• gk963872
• cxTi9083
• k1007
• k1016
• k1012
• k1002
• k1011
• gk953920
• tm1817
• gk115279
• gk115280
• gk115281
• gk115282
• gk115276
• gk115277
• lax101
• gk115278
• gk115287
• lax123
• gk115288
• lax124
• lax126
• lax129
• lax134
• gk115283
• gk115284

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00008419
• Start: 7595776
• End: 7602221
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_7602222..7602306
• Length (nt): 85
• Chromosome Location: I: 7602222-7602306
• Organism: Caenorhabditis elegans

159 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Bacteria: E.faecalis strain OG1RF	Transcripts that showed significantly increased expression after infection by E. faecalis OG1RF.	Ballgown was used to calculate differential expression of genes using FPKM data and to generate tables with fold change and P values. Genes were shortlisted with a cutoff of 2-fold change and P values of less than 0.05.	WBPaper00059754:E.faecalis_OG1RF_upregulated
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage.	DEseq2, fold change > 2	WBPaper00064505:tamoxifen_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in clk-1(qm30) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:clk-1(qm30)_upregulated
	Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:isp-1(qm150)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated

17 Expression Patterns

• Primary Identifier: Expr5627
• Remark: Strain: BC11003
• Reporter Gene: [D2030.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCCCGTTCAAACTGAACAA] 3' and primer B 5' [TTCGAGCATAGGGCGAAG] 3'.
• Pattern: Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr5628
• Remark: Also expressed in (comments from author) : unidentified cells near vulva. Strain: BC11362
• Reporter Gene: [D2030.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCCCGTTCAAACTGAACAA] 3' and primer B 5' [TTCGAGCATAGGGCGAAG] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in body ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in body

• Primary Identifier: Expr1019577
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr10823
• Pattern: wdr-23b was detected in muscle, hypodermis, and intestine, but not in neurons.

• Primary Identifier: Expr10825
• Pattern: wdr-23a was detected in the hypodermis (skin), intestine, muscle and neurons.

• Primary Identifier: Expr13653
• Pattern: Tissues with consistent wdr-23a and wdr-23b GFP expression in three independent lines included the intestine, hypodermis, and muscle. GFP was also observed in other less-recognizable cells in the head and tail.

• Primary Identifier: Expr1033654
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr13658
• Pattern: wdr-23 is expressed with SKN-1b in ASI neurons.

• Primary Identifier: Expr2036190
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr8582
• Remark: Picture: Figure 5C.
• Pattern: WDR-23::GFP is expressed in nuclei of the hypodermis, intestine and head neurons.
• Subcellular Localization: nuclei

• Primary Identifier: Expr10824
• Subcellular Localization: WDR-23b-GFP was entirely nuclear.

• Primary Identifier: Expr10826
• Subcellular Localization: WDR-23a-GFP adopted a ring-like pattern of fluorescence in the intestinal cytoplasm. In muscles, WDR-23a-GFP fluorescence was observed at dense bodies, which are actin rich-sites of muscle attachment to the hypodermis, and on ring-like structures similar to those seen in the intestine. WDR-23a-GFP may be associated with outer mitochondrial membranes.

• Primary Identifier: Expr2018053
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11499
• Subcellular Localization: In cholinergic neurons of the ventral cord, a WDR-23a::GFP fusion protein was found in cell bodies and in axons where it adopted a punctate pattern of fluorescence. In axons, WDR-23a puncta co-localized with a synaptic vesicle marker. WDR-23a may associate with presynaptic organelles, including mitochondria, at synapses. Consistent with this, WDR-23a co-localizes with outer mitochondrial membrane markers when expressed in muscle cells.

• Primary Identifier: Expr11498
• Subcellular Localization: WDR-23b::GFP localized exclusively to nuclei.

• Primary Identifier: Expr1147472
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr3627
• Subcellular Localization: Expressed in cell body/nucleus.

24 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00008419
• Start: 7595776
• End: 7602221
• Strand: 1

24 Ontology Annotations

5 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101.	DESeq2, Fold Change > 2 or < 0.5.	WBPaper00059566:wdr-23(mac32)_upregulated
	Genes up-regulated in wdr-23(tm1817) mutants comparing to in N2.	Differentially expressed genes at false discovery rate (FDR) of 0.05 were identified using the Cuffdiff module of the Cufflinks package.	WBPaper00042215:wdr-23(tm1817)_upregulated
	Genes that showed increased mRNA expression in wdr-23(tm1817) comparing to in N2, and was rescued in wdr-23(tm1817);nuIs225[Pmyo-2::GFP, Psnb-1::WDR-23a].	Differentially expressed genes at false discovery rate (FDR) of 0.05 were identified using the Cuffdiff module of the Cufflinks package.	WBPaper00044743:wdr-23_neuron_upregulated
	Transcripts that showed significantly decreased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101.	DESeq2, Fold Change > 2 or < 0.5.	WBPaper00059566:wdr-23(mac32)_downregulated
	Genes down-regulated in wdr-23(tm1817) mutants comparing to in N2.	Differentially expressed genes at false discovery rate (FDR) of 0.05 were identified using the Cuffdiff module of the Cufflinks package.	WBPaper00042215:wdr-23(tm1817)_downregulated

1 Sequence

• Length: 6446

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00055405
• WBStrain00005861
• WBStrain00005859
• WBStrain00001583
• WBStrain00001735

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_7595373..7595775
• Length (nt): 403
• Chromosome Location: I: 7595373-7595775
• Organism: Caenorhabditis elegans