WormMine: Gene WBGene00017381

• WormBase Gene ID: WBGene00017381
• Gene Name: ddr-2
• Sequence Name: F11D5.3
• Brief Description: F11D5.3 encodes a putative tyrosine kinase homologous to human RS1 (OMIM:312700, mutated in juvenile X-linked retinoschisis).
• Organism: Caenorhabditis elegans
• Automated Description: Enables protein tyrosine kinase activity. Involved in interneuron axon guidance; motor neuron axon guidance; and positive regulation of axon regeneration. Located in axon and plasma membrane. Expressed in DD neuron; SAB; hypodermis; rectal gland cell; and tail. Human ortholog(s) of this gene implicated in several diseases, including bone disease (multiple); carcinoma (multiple); and gastrointestinal system cancer (multiple). Is an ortholog of human DDR1 (discoidin domain receptor tyrosine kinase 1).
• Biotype: SO:0001217
• Genetic Position: X :-10.4705 ±0.029718
• Length (nt): 8929

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00017381

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F11D5.3a.1	F11D5.3a.1	2705	X: 3315314-3324242
Transcript:F11D5.3b.1	F11D5.3b.1	3313	X: 3317056-3324150
Transcript:F11D5.3b.2	F11D5.3b.2	2466	X: 3317667-3323964

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F11D5.3b	F11D5.3b	2304	X: 3317879-3317961
CDS:F11D5.3a	F11D5.3a	2394	X: 3315347-3315413

5 RNAi Result

• WBRNAi00066978
• WBRNAi00044385
• WBRNAi00013132
• WBRNAi00030822
• WBRNAi00093017

140 Allele

• gk963725
• gk964260
• gk963707
• WBVar01757989
• WBVar01757988
• WBVar01757990
• WBVar01757992
• WBVar01757991
• WBVar01757994
• WBVar01757993
• WBVar01757995
• WBVar01601358
• WBVar01601359
• WBVar01601360
• gk950924
• WBVar01980128
• WBVar01822508
• gk767291
• tm13137
• WBVar00244151
• gk770688
• WBVar01878062
• gk275579
• gk654608
• gk621152
• gk275567
• gk275566
• WBVar00077052
• WBVar00077053
• WBVar00077054

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00017381
• Start: 3315314
• End: 3324242
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_3324243..3325165
• Length (nt): 923
• Chromosome Location: X: 3324243-3325165
• Organism: Caenorhabditis elegans

163 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 4 hours at 25C.	Transcripts that showed significantly decreased expression after N2 L4 animals were infected by P. aeruginosa (PA14) bacteria for 24 hours at 25C.	DESeq R package (1.18.0), FDR < 0.05 and fold change > 2.	WBPaper00062184:PA14_downregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated
	Transcripts that showed significantly altered expression in rnp-6(dh1127) animals comparing to in N2 when fed with live S. aureus.	Differentially expressed genes (DEGs) (q-value <0.05) between different samples were identified using the stringtie version 1.3.0, followed by Cufflinks version 2.2.	WBPaper00059824:rnp-6(dh1127)_regulated_S.aureus
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated

12 Expression Patterns

• Primary Identifier: Expr2035280
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5738
• Remark: Strain: BC10576
• Reporter Gene: [F11D5.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAAACAAGCCATTTCCCCC] 3' and primer B 5' [GCAGCAACTTGATCCTGACA] 3'.
• Pattern: Adult Expression: arcade cells; intestine; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: arcade cells; intestine; Nervous System; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5739
• Remark: Also expressed in (comments from author) : No comments. Strain: BC10719
• Reporter Gene: [F11D5.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAAACAAGCCATTTCCCCC] 3' and primer B 5' [GCAGCAACTTGATCCTGACA] 3'.
• Pattern: Adult Expression: intestine; anal depressor muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: intestine; anal depressor muscle; Reproductive System; developing gonad; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr10586
• Pattern: ddr-2p::GFP reporter gene expression began at the end of gastrulation with strong expression in hypodermal cells and later also in a few neurons in the head. Post-embryonically neuronal expression was limited to a subgroup of neurons in the head and tail and some motor neurons in the VNC. Expression outside the nervous system was most prominent in seam cells, rectal gland cells and several non-neuronal cells in the tail. The DDR-2::GFP translational fusion co-localized with a PVP marker confirming the expression of DDR-2 in the PVP neurons.
• Subcellular Localization: DDR-2::GFP localized to neuronal cell bodies and axons.

• Primary Identifier: Expr13231
• Pattern: ddr-2 gene is expressed in D- type motor neurons using the transgene Pddr-2::nls::venus, which consists of the ddr-2 promoter driving the fluorescent protein VENUS fused to the nuclear localization signal (NLS).

• Primary Identifier: Expr12297
• Pattern: A reporter for the receptor tyrosine kinase encoding-gene ddr-2 shows expression only in SABV(not SABD) neurons.

• Primary Identifier: Expr1037474
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1148331
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1016535
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017144
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr14835
• Subcellular Localization: Wild-type DDR-2::GFP showed a punctate localization pattern in D-type motor axons.

• Primary Identifier: Chronogram1414
• Remark: Original chronogram file: chronogram.295.xml
• Reporter Gene: [F11D5.3:gfp] transcriptional fusion.

35 GO Annotation

32 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00017381
• Start: 3315314
• End: 3324242
• Strand: 1

35 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 8929

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00031501
• WBStrain00050782
• WBStrain00001486
• WBStrain00001413

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_3315309..3315313
• Length (nt): 5
• Chromosome Location: X: 3315309-3315313
• Organism: Caenorhabditis elegans