WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00016037 Gene Name  dop-6
Sequence Name  ? C24A8.1 Brief Description  dop-6 encodes an homolog of mammalian D2 or D3 dopamine receptors, and a paralog of DOP-2/-3; dop-6 is expressed in the nervous system; because of its paralogy, DOP-6 might act redundantly with DOP-2 to promote the basal slowing response to bacterial feeding, or it might account for the residual response to excess dopamine seen in triple dop-1/-2/-3 mutants; but dop-6 otherwise has no obvious function in RNAi assays of brood size, egg laying, pharyngeal pumping, locomotion, or male mating.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable G protein-coupled serotonin receptor activity and neurotransmitter receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger; cellular response to dopamine; and chemical synaptic transmission. Predicted to be located in dendrite and plasma membrane. Expressed in several structures, including AVF; SMDVL; head neurons; intestine; and lumbar neurons.
Biotype  SO:0001217 Genetic Position  X :-7.78823 ±0.001646
Length (nt)  ? 6469
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00016037

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C24A8.1.1 C24A8.1.1 2079   X: 4320863-4327331
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C24A8.1 C24A8.1 2079   X: 4320863-4321045

8 RNAi Result

WormBase ID
WBRNAi00041057
WBRNAi00072194
WBRNAi00011084
WBRNAi00069717
WBRNAi00069701
WBRNAi00069725
WBRNAi00069709
WBRNAi00069733

46 Allele

Public Name
gk963725
gk964260
WBVar02121349
WBVar02122727
WBVar02123953
WBVar02123331
WBVar01758191
WBVar01758190
WBVar01758192
WBVar01758189
WBVar01601536
WBVar02068993
WBVar00077740
WBVar00077739
WBVar00077738
WBVar00077737
WBVar02027029
WBVar02027031
WBVar02027030
h12502
WBVar01980393
gk961865
WBVar01945150
gk481236
gk711450
gk880394
gk605981
gk643980
gk346471
gk350322

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00016037 4320863 4327331 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_4327332..4328399   1068 X: 4327332-4328399 Caenorhabditis elegans

104 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression in pri-1(RNAi) animals comparing to in N2 animals fed with empty vector. Differential expression analysis was performed quasi-likelihood F-test with the generalized linear model (GLM) approach in edgeR ver 3.32.1. FDR < 0.05, fold change > 2. WBPaper00066418:pri-1(RNAi)_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_upregulated
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. WBPaper00040858:eQTL_regulated_reproductive
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage. DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed. WBPaper00048971:daf-16(mgDf50)_downregulated_L1
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(tm1630)_downregulated
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
Starvation 48 hours at L1 arrest Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest) Fold change > 2. WBPaper00064005:starvation_upregulated_N2_mRNA
  Genes with significantly increased expression in eat-2(ad465) treated with 2% DMSO for 72 hours, comparing to in N2 treated with 2% DMSO for 72 hours. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:eat-2(ad465)_upregulated_in-DMSO
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
Dietary restriction Transcripts that showed significantly increased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition. Bioconductor package edgeR, p < 0.05. WBPaper00056443:DietaryRestriction_upregulated
UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the second UVC dose (24h). Genes differentially expressed under UVC exposure and EtBr treatment vs under EtBr treatment but without UVC exposure at the -25h timepoint (just prior to the second UVC dose (24h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:UVC-EtBr-exposed_vs_EtBr-exposed_24h
  Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva. Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1). WBPaper00053295:lin-22(ot269)_upregulated
  Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2. DESeq2 Benjamini-Hochberg adjusted p-value < 0.05. WBPaper00049545:jmjd-3.1(+)_upregulated

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4335 No expression detected.  
Also expressed in (comments from author) : Low intensity GFP Strain: BC13771 [C24A8.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACATGGTTTTTGAACTGGAAAGT] 3' and primer B 5' [ATTTCCGATTCGTTGATCAGT] 3'. Expr5322 Adult Expression: Nervous System; head neurons; unidentified cells in tail ; Larval Expression: Nervous System; head neurons; unidentified cells in tail ;  
    Expr15336    
    Expr13040    
    Expr2011031 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr11993    
    Expr2029268 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1013995 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1145095 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

20 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in

12 Homologues

Type
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00016037 4320863 4327331 1

20 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
6469

1 Sequence Ontology Term

Identifier Name Description
gene  

3 Strains

WormBase ID
WBStrain00032373
WBStrain00062505
WBStrain00062472

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_4319308..4320862   1555 X: 4319308-4320862 Caenorhabditis elegans